SLC39A7 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52540-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SLC39A7 Reagents

CRO Services

Product recommended


All SLC39A7 Reagents

SLC39A7 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Description
Full length Clone DNA of Mouse solute carrier family 39 (zinc transporter), member 7 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC39A7 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AA408174 cDNA ORF Clone, Mouse;AI117660 cDNA ORF Clone, Mouse;AL024048 cDNA ORF Clone, Mouse;H-2Ke4 cDNA ORF Clone, Mouse;H2-Ke4 cDNA ORF Clone, Mouse;Ke-4 cDNA ORF Clone, Mouse;Ke4 cDNA ORF Clone, Mouse;Ring5 cDNA ORF Clone, Mouse;Zip7 cDNA ORF Clone, Mouse

SLC39A7 Background Information

Full Name
solute carrier family 39 (zinc transporter), member 7

SLC39A7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC39A7 cDNA ORF Clone in Cloning Vector, Mouse MG52540-G
SLC39A7 cDNA ORF Clone, Mouse, untagged MG52540-UT
SLC39A7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52540-ACGLN
SLC39A7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52540-ACG
SLC39A7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52540-ACR
SLC39A7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52540-CF
SLC39A7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52540-NF
SLC39A7 cDNA ORF Clone, Mouse, C-His tag MG52540-CH
SLC39A7 cDNA ORF Clone, Mouse, C-HA tag MG52540-CY
SLC39A7 cDNA ORF Clone, Mouse, N-HA tag MG52540-NY
SLC39A7 cDNA ORF Clone, Mouse, C-Myc tag MG52540-CM
SLC39A7 cDNA ORF Clone, Mouse, N-Myc tag MG52540-NM
SLC39A7 qPCR Primer Pairs, Mouse MP202413

SLC39A7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC39A7 cDNA ORF Clone in Cloning Vector, Human HG16934-U
SLC39A7 cDNA ORF Clone, Human, untagged HG16934-UT
SLC39A7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16934-ACG
SLC39A7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16934-ACGLN
SLC39A7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16934-ACR
SLC39A7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16934-CF
SLC39A7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16934-NF
SLC39A7 cDNA ORF Clone, Human, C-His tag HG16934-CH
SLC39A7 cDNA ORF Clone, Human, N-His tag HG16934-NH
SLC39A7 cDNA ORF Clone, Human, C-HA tag HG16934-CY
SLC39A7 cDNA ORF Clone, Human, N-HA tag HG16934-NY
SLC39A7 cDNA ORF Clone, Human, C-Myc tag HG16934-CM
SLC39A7 cDNA ORF Clone, Human, N-Myc tag HG16934-NM
info info
添加购物车成功! 添加购物车失败!