SNX11 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51612-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SNX11 Reagents

CRO Services

Product recommended


All SNX11 Reagents

SNX11 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Mouse sorting nexin 11 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX11 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

4933439F10Rik cDNA ORF Clone, Mouse;A930041K09Rik cDNA ORF Clone, Mouse;AI117694 cDNA ORF Clone, Mouse

SNX11 Background Information

Full Name
sorting nexin 11

SNX11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SNX11 cDNA ORF Clone in Cloning Vector, Rhesus CG90385-G
SNX11 cDNA ORF Clone, Rhesus, untagged CG90385-UT
SNX11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90385-ACG
SNX11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90385-ACGLN
SNX11 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90385-ANG
SNX11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90385-ACR
SNX11 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90385-ANR
SNX11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90385-CF
SNX11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90385-NF
SNX11 cDNA ORF Clone, Rhesus, C-His tag CG90385-CH
SNX11 cDNA ORF Clone, Rhesus, N-His tag CG90385-NH
SNX11 cDNA ORF Clone, Rhesus, C-HA tag CG90385-CY
SNX11 cDNA ORF Clone, Rhesus, N-HA tag CG90385-NY
SNX11 cDNA ORF Clone, Rhesus, C-Myc tag CG90385-CM
SNX11 cDNA ORF Clone, Rhesus, N-Myc tag CG90385-NM

SNX11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX11 cDNA ORF Clone in Cloning Vector, Mouse MG51612-U
SNX11 cDNA ORF Clone, Mouse, untagged MG51612-UT
SNX11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51612-ACGLN
SNX11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51612-ACG
SNX11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51612-ANG
SNX11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51612-ACR
SNX11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51612-ANR
SNX11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51612-CF
SNX11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51612-NF
SNX11 cDNA ORF Clone, Mouse, C-His tag MG51612-CH
SNX11 cDNA ORF Clone, Mouse, N-His tag MG51612-NH
SNX11 cDNA ORF Clone, Mouse, C-HA tag MG51612-CY
SNX11 cDNA ORF Clone, Mouse, N-HA tag MG51612-NY
SNX11 cDNA ORF Clone, Mouse, N-Myc tag MG51612-NM
SNX11 qPCR Primer Pairs, Mouse MP201279

SNX11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX11 cDNA ORF Clone, Human, untagged HG24857-UT
info info
添加购物车成功! 添加购物车失败!