SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51603-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SOSTDC1 Reagents

CRO Services

Product recommended


All SOSTDC1 Reagents

SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Mouse sclerostin domain containing 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

0610006G05Rik cDNA ORF Clone, Mouse;ectodin cDNA ORF Clone, Mouse;Sostl cDNA ORF Clone, Mouse;USAG-1 cDNA ORF Clone, Mouse;Wise cDNA ORF Clone, Mouse

SOSTDC1 Background Information

Full Name
sclerostin domain containing 1

SOSTDC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SOSTDC1 cDNA ORF Clone in Cloning Vector, Mouse MG51603-U
SOSTDC1 cDNA ORF Clone, Mouse, untagged MG51603-UT
SOSTDC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51603-ACGLN
SOSTDC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51603-ACG
SOSTDC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51603-ACR
SOSTDC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51603-CF
SOSTDC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51603-NF
SOSTDC1 cDNA ORF Clone, Mouse, C-His tag MG51603-CH
SOSTDC1 cDNA ORF Clone, Mouse, N-His tag MG51603-NH
SOSTDC1 cDNA ORF Clone, Mouse, C-HA tag MG51603-CY
SOSTDC1 cDNA ORF Clone, Mouse, N-HA tag MG51603-NY
SOSTDC1 cDNA ORF Clone, Mouse, N-Myc tag MG51603-NM
SOSTDC1 qPCR Primer Pairs, Mouse MP201486

SOSTDC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SOSTDC1 cDNA ORF Clone in Cloning Vector, Human HG12127-M
SOSTDC1 cDNA ORF Clone, Human, untagged HG12127-UT
SOSTDC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12127-ACGLN
SOSTDC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12127-ACG
SOSTDC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12127-ACR
SOSTDC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12127-CF
SOSTDC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12127-NF
SOSTDC1 cDNA ORF Clone, Human, C-His tag HG12127-CH
SOSTDC1 cDNA ORF Clone, Human, N-His tag HG12127-NH
SOSTDC1 cDNA ORF Clone, Human, C-HA tag HG12127-CY
SOSTDC1 cDNA ORF Clone, Human, N-HA tag HG12127-NY
SOSTDC1 cDNA ORF Clone, Human, C-Myc tag HG12127-CM
SOSTDC1 cDNA ORF Clone, Human, N-Myc tag HG12127-NM
SOSTDC1 qPCR Primer Pairs, Human HP101653
info info
添加购物车成功! 添加购物车失败!