쥐 SPN/CD43 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     SPN cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001037810.1
    cDNA 크기:1188bp
    cDNA 설명:Full length Clone DNA of Mus musculus sialophorin with N terminal His tag.
    유전자 동의어:Cd43, Ly48, Galgp, Ly-48, A630014B01Rik, Spn
    :Mouse
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPN qPCR primers for gene expression analysis, MP200710 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

    참고자료
  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
  • Size / Price
    Cat No: MG50735-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".