After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Mouse SRC cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009271.3
cDNA 크기:1626bp
cDNA 설명:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with C terminal HA tag.
유전자 동의어:AW259666, pp60c-src, Src
:Mouse
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그 on other vectors
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그MG51118-ACG288840
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그MG51118-ACR288840
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그MG51118-ANG288840
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그MG51118-ANR288840
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG51118-CF253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그MG51118-CH253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그MG51118-CM253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그MG51118-CY253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone in cloning vectorMG51118-G88420
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그MG51118-G-F253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그MG51118-NF253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그MG51118-NH253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그MG51118-NM253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그MG51118-NY253470
쥐 SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmidMG51118-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

참고자료
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Cat No: MG51118-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".