After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 ST6GAL1/ST6GAL-I Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Mouse ST6GAL1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_145933.3
cDNA 크기:1212bp
cDNA 설명:Full length Clone DNA of Mus musculus beta galactoside alpha 2,6 sialyltransferase 1 with N terminal His tag.
유전자 동의어:Siat1, St6gal, St6galI, AW742324, MGC116663, St6gal1
:Mouse
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

참고자료
  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    Cat No: MG50740-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".