STK17B cDNA ORF Clone, Mouse, N-His tag

Cat: MG52694-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STK17B Reagents

CRO Services

Product recommended


All STK17B Reagents

STK17B cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Mouse serine/threonine kinase 17b (apoptosis-inducing) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STK17B cDNA ORF Clone, Mouse, N-His tag Alternative Names

3110009A03Rik cDNA ORF Clone, Mouse;AI120141 cDNA ORF Clone, Mouse;Drak2 cDNA ORF Clone, Mouse

STK17B Background Information

Full Name
serine/threonine kinase 17b

STK17B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STK17B cDNA ORF Clone in Cloning Vector, Mouse MG52694-G
STK17B cDNA ORF Clone, Mouse, untagged MG52694-UT
STK17B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52694-ACGLN
STK17B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52694-ACG
STK17B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52694-ACR
STK17B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52694-CF
STK17B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52694-NF
STK17B cDNA ORF Clone, Mouse, C-His tag MG52694-CH
STK17B cDNA ORF Clone, Mouse, C-HA tag MG52694-CY
STK17B cDNA ORF Clone, Mouse, N-HA tag MG52694-NY
STK17B cDNA ORF Clone, Mouse, C-Myc tag MG52694-CM
STK17B cDNA ORF Clone, Mouse, N-Myc tag MG52694-NM
STK17B qPCR Primer Pairs, Mouse MP202565

STK17B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STK17B cDNA ORF Clone in Cloning Vector, Human HG11586-M
STK17B cDNA ORF Clone, Human, untagged HG11586-UT
STK17B cDNA ORF Clone, Human, C-GFPSpark® tag HG11586-ACG
STK17B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11586-ACGLN
STK17B cDNA ORF Clone, Human, C-OFPSpark® tag HG11586-ACR
STK17B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11586-CF
STK17B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11586-NF
STK17B cDNA ORF Clone, Human, C-His tag HG11586-CH
STK17B cDNA ORF Clone, Human, N-His tag HG11586-NH
STK17B cDNA ORF Clone, Human, C-HA tag HG11586-CY
STK17B cDNA ORF Clone, Human, N-HA tag HG11586-NY
STK17B cDNA ORF Clone, Human, C-Myc tag HG11586-CM
STK17B cDNA ORF Clone, Human, N-Myc tag HG11586-NM
STK17B qPCR Primer Pairs, Human HP101452
info info
添加购物车成功! 添加购物车失败!