TCF25 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52531-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TCF25 Reagents

CRO Services

Product recommended


All TCF25 Reagents

TCF25 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1878 bp
Description
Full length Clone DNA of Mouse transcription factor 25 (basic helix-loop-helix) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCF25 cDNA ORF Clone, Mouse, N-His tag Alternative Names

1100001J13Rik cDNA ORF Clone, Mouse;1810041K11Rik cDNA ORF Clone, Mouse;D8Ertd325e cDNA ORF Clone, Mouse;mKIAA1049 cDNA ORF Clone, Mouse;Nulp1 cDNA ORF Clone, Mouse

TCF25 Background Information

Full Name
transcription factor 25 (basic helix-loop-helix)

TCF25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Rat RG81622-G
TCF25 cDNA ORF Clone, Rat, untagged RG81622-UT
TCF25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81622-ACGLN
TCF25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81622-ACG
TCF25 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81622-ANG
TCF25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81622-ACR
TCF25 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81622-ANR
TCF25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81622-CF
TCF25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81622-NF
TCF25 cDNA ORF Clone, Rat, C-His tag RG81622-CH
TCF25 cDNA ORF Clone, Rat, N-His tag RG81622-NH
TCF25 cDNA ORF Clone, Rat, C-HA tag RG81622-CY
TCF25 cDNA ORF Clone, Rat, N-HA tag RG81622-NY
TCF25 cDNA ORF Clone, Rat, C-Myc tag RG81622-CM
TCF25 cDNA ORF Clone, Rat, N-Myc tag RG81622-NM

TCF25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Mouse MG52531-G
TCF25 cDNA ORF Clone, Mouse, untagged MG52531-UT
TCF25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52531-ACGLN
TCF25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52531-ACG
TCF25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52531-ANG
TCF25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52531-ACR
TCF25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52531-ANR
TCF25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52531-CF
TCF25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52531-NF
TCF25 cDNA ORF Clone, Mouse, C-His tag MG52531-CH
TCF25 cDNA ORF Clone, Mouse, C-HA tag MG52531-CY
TCF25 cDNA ORF Clone, Mouse, N-HA tag MG52531-NY
TCF25 cDNA ORF Clone, Mouse, C-Myc tag MG52531-CM
TCF25 cDNA ORF Clone, Mouse, N-Myc tag MG52531-NM
TCF25 qPCR Primer Pairs, Mouse MP202404

TCF25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Human HG17175-U
TCF25 cDNA ORF Clone, Human, untagged HG17175-UT
TCF25 cDNA ORF Clone, Human, C-GFPSpark® tag HG17175-ACG
TCF25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17175-ACGLN
TCF25 cDNA ORF Clone, Human, N-GFPSpark® tag HG17175-ANG
TCF25 cDNA ORF Clone, Human, C-OFPSpark® tag HG17175-ACR
TCF25 cDNA ORF Clone, Human, N-OFPSpark® tag HG17175-ANR
TCF25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17175-CF
TCF25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17175-NF
TCF25 cDNA ORF Clone, Human, C-His tag HG17175-CH
TCF25 cDNA ORF Clone, Human, N-His tag HG17175-NH
TCF25 cDNA ORF Clone, Human, C-HA tag HG17175-CY
TCF25 cDNA ORF Clone, Human, N-HA tag HG17175-NY
TCF25 cDNA ORF Clone, Human, C-Myc tag HG17175-CM
TCF25 cDNA ORF Clone, Human, N-Myc tag HG17175-NM
info info
添加购物车成功! 添加购物车失败!