TECR cDNA ORF Clone, Mouse, N-His tag

Cat: MG52534-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TECR Reagents

CRO Services

Product recommended


All TECR Reagents

TECR cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Mouse trans-2,3-enoyl-CoA reductase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TECR cDNA ORF Clone, Mouse, N-His tag Alternative Names

2410016D23Rik cDNA ORF Clone, Mouse;A230102P12Rik cDNA ORF Clone, Mouse;AI173355 cDNA ORF Clone, Mouse;D17Ertd178e cDNA ORF Clone, Mouse;Gpsn2 cDNA ORF Clone, Mouse;SC2 cDNA ORF Clone, Mouse

TECR Background Information

Full Name
trans-2,3-enoyl-CoA reductase

TECR cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Rat RG80660-U
TECR cDNA ORF Clone, Rat, untagged RG80660-UT
TECR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80660-ACG
TECR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80660-ACGLN
TECR cDNA ORF Clone, Rat, N-GFPSpark® tag RG80660-ANG
TECR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80660-ACR
TECR cDNA ORF Clone, Rat, N-OFPSpark® tag RG80660-ANR
TECR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80660-CF
TECR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80660-NF
TECR cDNA ORF Clone, Rat, C-His tag RG80660-CH
TECR cDNA ORF Clone, Rat, N-His tag RG80660-NH
TECR cDNA ORF Clone, Rat, C-HA tag RG80660-CY
TECR cDNA ORF Clone, Rat, N-HA tag RG80660-NY
TECR cDNA ORF Clone, Rat, C-Myc tag RG80660-CM
TECR cDNA ORF Clone, Rat, N-Myc tag RG80660-NM
TECR qPCR Primer Pairs, Rat RP300624

TECR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Mouse MG52534-G
TECR cDNA ORF Clone, Mouse, untagged MG52534-UT
TECR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52534-ACG
TECR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52534-ACGLN
TECR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52534-ACR
TECR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52534-CF
TECR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52534-NF
TECR cDNA ORF Clone, Mouse, C-His tag MG52534-CH
TECR cDNA ORF Clone, Mouse, C-HA tag MG52534-CY
TECR cDNA ORF Clone, Mouse, N-HA tag MG52534-NY
TECR cDNA ORF Clone, Mouse, C-Myc tag MG52534-CM
TECR cDNA ORF Clone, Mouse, N-Myc tag MG52534-NM
TECR qPCR Primer Pairs, Mouse MP202407

TECR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TECR cDNA ORF Clone in Cloning Vector, Human HG16183-G
TECR cDNA ORF Clone, Human, untagged HG16183-UT
TECR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16183-ACGLN
TECR cDNA ORF Clone, Human, C-GFPSpark® tag HG16183-ACG
TECR cDNA ORF Clone, Human, C-OFPSpark® tag HG16183-ACR
TECR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16183-CF
TECR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16183-NF
TECR cDNA ORF Clone, Human, C-His tag HG16183-CH
TECR cDNA ORF Clone, Human, N-His tag HG16183-NH
TECR cDNA ORF Clone, Human, C-HA tag HG16183-CY
TECR cDNA ORF Clone, Human, N-HA tag HG16183-NY
TECR cDNA ORF Clone, Human, C-Myc tag HG16183-CM
TECR cDNA ORF Clone, Human, N-Myc tag HG16183-NM
TECR qPCR Primer Pairs, Human HP104952
info info
添加购物车成功! 添加购物车失败!