After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Tie2/CD202b/TEK Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Mouse TEK cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013690.2
cDNA 크기:3372bp
cDNA 설명:Full length Clone DNA of Mus musculus endothelial-specific receptor tyrosine kinase with C terminal His tag.
유전자 동의어:Hyk, Tie2, tie-2, Cd202b, AA51
:Mouse
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.

참고자료
  • Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.
  • Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.
  • Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.
  • Size / Price
    Cat No: MG51087-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".