After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CD90/THY-1 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Mouse THY1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_009382.3
cDNA 크기:489bp
cDNA 설명:Full length Clone DNA of Mus musculus thymus cell antigen 1, theta with C terminal His tag.
유전자 동의어:T25, CD90, Thy-1, Thy1.1, Thy1.2, Thy-1.2, Thy1
:Mouse
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

참고자료
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Cat No: MG50461-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".