TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50342-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TIMP-1 Reagents

CRO Services

Product recommended


All TIMP-1 Reagents

TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Mouse tissue inhibitor of metalloproteinase 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIMP-1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

Clgi cDNA ORF Clone, Mouse;EPA cDNA ORF Clone, Mouse;Timp cDNA ORF Clone, Mouse;TIMP-1 cDNA ORF Clone, Mouse;TPA-S1 cDNA ORF Clone, Mouse

TIMP-1 Background Information

TIMP metallopeptidase inhibitor 1, also known as TIMP-1/TIMP1, Collagenase inhibitor 16C8 fibroblast Erythroid-potentiating activity, TPA-S1TPA-induced proteinTissue inhibitor of metalloproteinases 1, is a natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. TIMP-1/TIMP1 is found in fetal and adult tissues. Highest levels are found in bone, lung, ovary and uterus. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 mediates erythropoiesis in vitro; but, unlike IL-3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors. In addition to its inhibitory role against most of the known MMPs, the protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this protein encoding gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This encoding gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 is Known to act on MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13 and MMP-16.

Full Name
TIMP metallopeptidase inhibitor 1
References
  • Hornebeck W (2004). Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growth and survival.. Pathol. Biol. 51 (10): 569-73.
  • Soini Y, et al. (2001) Expression of MMP2, MMP9, MT1-MMP, TIMP-1, and TIMP2 mRNA in valvular lesions of the heart. J Pathol. 194(2):225-31.
  • Wang X, et al. (1999) Analysis of coding sequences for tissue inhibitor of metalloproteinases 1 (TIMP-1) and 2 (TIMP2) in patients with aneurysms. Matrix Biol. 18(2):121-4.
  • TIMP-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TIMP-1 cDNA ORF Clone in Cloning Vector, Rat RG80064-M
    TIMP-1 cDNA ORF Clone, Rat, untagged RG80064-UT
    TIMP-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80064-ACGLN
    TIMP-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80064-ACG
    TIMP-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80064-ACR
    TIMP-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80064-CF
    TIMP-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80064-NF
    TIMP-1 cDNA ORF Clone, Rat, C-His tag RG80064-CH
    TIMP-1 cDNA ORF Clone, Rat, N-His tag RG80064-NH
    TIMP-1 cDNA ORF Clone, Rat, C-HA tag RG80064-CY
    TIMP-1 cDNA ORF Clone, Rat, N-HA tag RG80064-NY
    TIMP-1 cDNA ORF Clone, Rat, C-Myc tag RG80064-CM
    TIMP-1 cDNA ORF Clone, Rat, N-Myc tag RG80064-NM
    TIMP-1 qPCR Primer Pairs, Rat RP300062

    TIMP-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TIMP-1 cDNA ORF Clone in Cloning Vector, Mouse MG50342-M
    TIMP-1 cDNA ORF Clone, Mouse, untagged MG50342-UT
    TIMP-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50342-ACG
    TIMP-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50342-ACGLN
    TIMP-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50342-ACR
    TIMP-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50342-CF
    TIMP-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50342-NF
    TIMP-1 cDNA ORF Clone, Mouse, C-His tag MG50342-CH
    TIMP-1 cDNA ORF Clone, Mouse, N-His tag MG50342-NH
    TIMP-1 cDNA ORF Clone, Mouse, C-HA tag MG50342-CY
    TIMP-1 cDNA ORF Clone, Mouse, N-HA tag MG50342-NY
    TIMP-1 cDNA ORF Clone, Mouse, N-Myc tag MG50342-NM
    TIMP-1 qPCR Primer Pairs, Mouse MP200072

    TIMP-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TIMP-1 cDNA ORF Clone in Cloning Vector, Human HG10934-M
    TIMP-1 cDNA ORF Clone, Human, untagged HG10934-UT
    TIMP-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10934-ACG
    TIMP-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10934-ACGLN
    TIMP-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10934-ACR
    TIMP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10934-CF
    TIMP-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10934-NF
    TIMP-1 cDNA ORF Clone, Human, C-His tag HG10934-CH
    TIMP-1 cDNA ORF Clone, Human, N-His tag HG10934-NH
    TIMP-1 cDNA ORF Clone, Human, C-HA tag HG10934-CY
    TIMP-1 cDNA ORF Clone, Human, N-HA tag HG10934-NY
    TIMP-1 cDNA ORF Clone, Human, C-Myc tag HG10934-CM
    TIMP-1 cDNA ORF Clone, Human, N-Myc tag HG10934-NM
    TIMP-1 qPCR Primer Pairs, Human HP100813
    info info
    添加购物车成功! 添加购物车失败!