TMEM9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51861-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TMEM9 Reagents

CRO Services

Product recommended


All TMEM9 Reagents

TMEM9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Mouse transmembrane protein 9 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

1500015G18Rik cDNA ORF Clone, Mouse;AW545782 cDNA ORF Clone, Mouse

TMEM9 Background Information

Full Name
transmembrane protein 9

TMEM9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM9 cDNA ORF Clone in Cloning Vector, Mouse MG51861-G
TMEM9 cDNA ORF Clone, Mouse, untagged MG51861-UT
TMEM9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51861-ACG
TMEM9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51861-ACGLN
TMEM9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51861-ACR
TMEM9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51861-CF
TMEM9 cDNA ORF Clone, Mouse, C-His tag MG51861-CH
TMEM9 cDNA ORF Clone, Mouse, N-His tag MG51861-NH
TMEM9 cDNA ORF Clone, Mouse, C-HA tag MG51861-CY
TMEM9 cDNA ORF Clone, Mouse, N-HA tag MG51861-NY
TMEM9 cDNA ORF Clone, Mouse, C-Myc tag MG51861-CM
TMEM9 cDNA ORF Clone, Mouse, N-Myc tag MG51861-NM
TMEM9 qPCR Primer Pairs, Mouse MP201734

TMEM9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM9 cDNA ORF Clone in Cloning Vector, Human HG13344-G
TMEM9 cDNA ORF Clone, Human, untagged HG13344-UT
TMEM9 cDNA ORF Clone, Human, C-GFPSpark® tag HG13344-ACG
TMEM9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13344-ACGLN
TMEM9 cDNA ORF Clone, Human, C-OFPSpark® tag HG13344-ACR
TMEM9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13344-CF
TMEM9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13344-NF
TMEM9 cDNA ORF Clone, Human, C-His tag HG13344-CH
TMEM9 cDNA ORF Clone, Human, N-His tag HG13344-NH
TMEM9 cDNA ORF Clone, Human, C-HA tag HG13344-CY
TMEM9 cDNA ORF Clone, Human, N-HA tag HG13344-NY
TMEM9 cDNA ORF Clone, Human, C-Myc tag HG13344-CM
TMEM9 cDNA ORF Clone, Human, N-Myc tag HG13344-NM
TMEM9 qPCR Primer Pairs, Human HP102049
info info
添加购物车成功! 添加购物车失败!