TNNT2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51609-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TNNT2 Reagents
CRO Services
Product recommended

All TNNT2 Reagents
TNNT2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Mouse troponin T2, cardiac with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNNT2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
cTnT cDNA ORF Clone, Mouse;Tnt cDNA ORF Clone, Mouse
TNNT2 Background Information
Full Name
troponin T type 2 (cardiac)

TNNT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TNNT2 cDNA ORF Clone in Cloning Vector, Rat RG82460-U
TNNT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82460-ACGLN

TNNT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TNNT2 cDNA ORF Clone in Cloning Vector, Mouse MG51609-U
TNNT2 cDNA ORF Clone, Mouse, untagged MG51609-UT
TNNT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51609-ACGLN
TNNT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51609-ACG
TNNT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51609-ANG
TNNT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51609-ACR
TNNT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51609-ANR
TNNT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51609-CF
TNNT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51609-NF
TNNT2 cDNA ORF Clone, Mouse, C-His tag MG51609-CH
TNNT2 cDNA ORF Clone, Mouse, N-His tag MG51609-NH
TNNT2 cDNA ORF Clone, Mouse, C-HA tag MG51609-CY
TNNT2 cDNA ORF Clone, Mouse, N-HA tag MG51609-NY
TNNT2 cDNA ORF Clone, Mouse, N-Myc tag MG51609-NM
TNNT2 qPCR Primer Pairs, Mouse MP201276

TNNT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TNNT2 cDNA ORF Clone in Cloning Vector, Human HG16002-G
TNNT2 cDNA ORF Clone, Human, untagged HG16002-UT
TNNT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16002-ACG
TNNT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16002-ACGLN
TNNT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16002-ANG
TNNT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16002-ACR
TNNT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16002-ANR
TNNT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16002-CF
TNNT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16002-NF
TNNT2 cDNA ORF Clone, Human, C-His tag HG16002-CH
TNNT2 cDNA ORF Clone, Human, N-His tag HG16002-NH
TNNT2 cDNA ORF Clone, Human, C-HA tag HG16002-CY
TNNT2 cDNA ORF Clone, Human, N-HA tag HG16002-NY
TNNT2 cDNA ORF Clone, Human, C-Myc tag HG16002-CM
TNNT2 cDNA ORF Clone, Human, N-Myc tag HG16002-NM
TNNT2 qPCR Primer Pairs, Human HP104588
info info
添加购物车成功! 添加购物车失败!