TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51853-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TRAP1 Reagents

CRO Services

Product recommended


All TRAP1 Reagents

TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2121 bp
Description
Full length Clone DNA of Mouse TNF receptor-associated protein 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

2410002K23Rik cDNA ORF Clone, Mouse;HSP75 cDNA ORF Clone, Mouse

TRAP1 Background Information

Full Name
TNF receptor-associated protein 1

TRAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TRAP1 cDNA ORF Clone in Cloning Vector, Rat RG85605-U
TRAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85605-ACGLN

TRAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TRAP1 cDNA ORF Clone in Cloning Vector, Mouse MG51853-U
TRAP1 cDNA ORF Clone, Mouse, untagged MG51853-UT
TRAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51853-ACGLN
TRAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51853-ACG
TRAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51853-ANG
TRAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51853-ACR
TRAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51853-ANR
TRAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51853-CF
TRAP1 cDNA ORF Clone, Mouse, C-His tag MG51853-CH
TRAP1 cDNA ORF Clone, Mouse, N-His tag MG51853-NH
TRAP1 cDNA ORF Clone, Mouse, C-HA tag MG51853-CY
TRAP1 cDNA ORF Clone, Mouse, N-HA tag MG51853-NY
TRAP1 cDNA ORF Clone, Mouse, C-Myc tag MG51853-CM
TRAP1 cDNA ORF Clone, Mouse, N-Myc tag MG51853-NM
TRAP1 qPCR Primer Pairs, Mouse MP201726

TRAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TRAP1 cDNA ORF Clone in Cloning Vector, Human HG16450-G
TRAP1 cDNA ORF Clone, Human, untagged HG16450-UT
TRAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16450-ACG
TRAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16450-ACGLN
TRAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16450-ANG
TRAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16450-ACR
TRAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16450-ANR
TRAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16450-CF
TRAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16450-NF
TRAP1 cDNA ORF Clone, Human, C-His tag HG16450-CH
TRAP1 cDNA ORF Clone, Human, N-His tag HG16450-NH
TRAP1 cDNA ORF Clone, Human, C-HA tag HG16450-CY
TRAP1 cDNA ORF Clone, Human, N-HA tag HG16450-NY
TRAP1 cDNA ORF Clone, Human, C-Myc tag HG16450-CM
TRAP1 cDNA ORF Clone, Human, N-Myc tag HG16450-NM
TRAP1 qPCR Primer Pairs, Human HP105196
info info
添加购物车成功! 添加购物车失败!