VCP cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52034-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VCP Reagents
CRO Services
Product recommended

All VCP Reagents
VCP cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2421 bp
Description
Full length Clone DNA of Mouse valosin containing protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VCP cDNA ORF Clone, Mouse, N-HA tag Alternative Names
311000100000 cDNA ORF Clone, Mouse;CDC48 cDNA ORF Clone, Mouse;p97 cDNA ORF Clone, Mouse;p97/VCP cDNA ORF Clone, Mouse
VCP Background Information
Full Name
valosin containing protein

VCP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VCP cDNA ORF Clone in Cloning Vector, Rat RG82583-U
VCP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82583-ACGLN

VCP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VCP cDNA ORF Clone in Cloning Vector, Mouse MG52034-U
VCP cDNA ORF Clone, Mouse, untagged MG52034-UT
VCP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52034-ACG
VCP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52034-ACGLN
VCP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52034-ANG
VCP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52034-ACR
VCP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52034-ANR
VCP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52034-CF
VCP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52034-NF
VCP cDNA ORF Clone, Mouse, C-His tag MG52034-CH
VCP cDNA ORF Clone, Mouse, N-His tag MG52034-NH
VCP cDNA ORF Clone, Mouse, C-HA tag MG52034-CY
VCP cDNA ORF Clone, Mouse, C-Myc tag MG52034-CM
VCP cDNA ORF Clone, Mouse, N-Myc tag MG52034-NM
VCP qPCR Primer Pairs, Mouse MP201907

VCP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VCP cDNA ORF Clone in Cloning Vector, Human HG17232-U
VCP cDNA ORF Clone, Human, untagged HG17232-UT
VCP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17232-ACGLN
VCP cDNA ORF Clone, Human, C-GFPSpark® tag HG17232-ACG
VCP cDNA ORF Clone, Human, N-GFPSpark® tag HG17232-ANG
VCP cDNA ORF Clone, Human, C-OFPSpark® tag HG17232-ACR
VCP cDNA ORF Clone, Human, N-OFPSpark® tag HG17232-ANR
VCP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17232-CF
VCP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17232-NF
VCP cDNA ORF Clone, Human, C-His tag HG17232-CH
VCP cDNA ORF Clone, Human, N-His tag HG17232-NH
VCP cDNA ORF Clone, Human, C-HA tag HG17232-CY
VCP cDNA ORF Clone, Human, N-HA tag HG17232-NY
VCP cDNA ORF Clone, Human, C-Myc tag HG17232-CM
VCP cDNA ORF Clone, Human, N-Myc tag HG17232-NM
info info
添加购物车成功! 添加购物车失败!