WBSCR22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51012-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WBSCR22 Reagents
CRO Services
Product recommended

All WBSCR22 Reagents
WBSCR22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Mouse Williams Beuren syndrome chromosome region 22 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WBSCR22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1110003N24Rik cDNA ORF Clone, Mouse
WBSCR22 Background Information
Full Name
Williams Beuren syndrome chromosome region 22

WBSCR22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WBSCR22 cDNA ORF Clone in Cloning Vector, Mouse MG51012-G
WBSCR22 cDNA ORF Clone, Mouse, untagged MG51012-UT
WBSCR22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51012-ACGLN
WBSCR22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51012-ACG
WBSCR22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51012-ANG
WBSCR22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51012-ACR
WBSCR22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51012-ANR
WBSCR22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51012-NF
WBSCR22 cDNA ORF Clone, Mouse, C-His tag MG51012-CH
WBSCR22 cDNA ORF Clone, Mouse, N-His tag MG51012-NH
WBSCR22 cDNA ORF Clone, Mouse, C-HA tag MG51012-CY
WBSCR22 cDNA ORF Clone, Mouse, N-HA tag MG51012-NY
WBSCR22 cDNA ORF Clone, Mouse, C-Myc tag MG51012-CM
WBSCR22 cDNA ORF Clone, Mouse, N-Myc tag MG51012-NM
WBSCR22 qPCR Primer Pairs, Mouse MP200972

WBSCR22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WBSCR22 cDNA ORF Clone in Cloning Vector, Human HG10935-M
WBSCR22 cDNA ORF Clone, Human, untagged HG10935-UT
WBSCR22 cDNA ORF Clone, Human, C-GFPSpark® tag HG10935-ACG
WBSCR22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10935-ACGLN
WBSCR22 cDNA ORF Clone, Human, N-GFPSpark® tag HG10935-ANG
WBSCR22 cDNA ORF Clone, Human, C-OFPSpark® tag HG10935-ACR
WBSCR22 cDNA ORF Clone, Human, N-OFPSpark® tag HG10935-ANR
WBSCR22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10935-CF
WBSCR22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10935-NF
WBSCR22 cDNA ORF Clone, Human, C-His tag HG10935-CH
WBSCR22 cDNA ORF Clone, Human, N-His tag HG10935-NH
WBSCR22 cDNA ORF Clone, Human, C-HA tag HG10935-CY
WBSCR22 cDNA ORF Clone, Human, N-HA tag HG10935-NY
WBSCR22 cDNA ORF Clone, Human, C-Myc tag HG10935-CM
WBSCR22 cDNA ORF Clone, Human, N-Myc tag HG10935-NM
WBSCR22 qPCR Primer Pairs, Human HP100814
info info
添加购物车成功! 添加购物车失败!