14‑3‑3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52938-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All 14‑3‑3 Reagents
CRO Services
Product recommended

All 14‑3‑3 Reagents
14‑3‑3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Mouse tyrosine 3-monooxygenase>tryptophan 5-monooxygenase activation protein, theta polypeptide with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

14‑3‑3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2700028P07Rik cDNA ORF Clone, Mouse;AA409740 cDNA ORF Clone, Mouse;AU021156 cDNA ORF Clone, Mouse;R74690 cDNA ORF Clone, Mouse
14‑3‑3 Background Information
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • 14‑3‑3 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    14‑3‑3 cDNA ORF Clone in Cloning Vector, Ferret FG60106-G
    14‑3‑3 cDNA ORF Clone, Ferret, untagged FG60106-UT
    14‑3‑3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60106-ACGLN
    14‑3‑3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60106-ACG
    14‑3‑3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60106-ANG
    14‑3‑3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60106-ACR
    14‑3‑3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60106-ANR
    14‑3‑3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60106-CF
    14‑3‑3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60106-NF
    14‑3‑3 cDNA ORF Clone, Ferret, C-His tag FG60106-CH
    14‑3‑3 cDNA ORF Clone, Ferret, N-His tag FG60106-NH
    14‑3‑3 cDNA ORF Clone, Ferret, C-HA tag FG60106-CY
    14‑3‑3 cDNA ORF Clone, Ferret, N-HA tag FG60106-NY
    14‑3‑3 cDNA ORF Clone, Ferret, C-Myc tag FG60106-CM
    14‑3‑3 cDNA ORF Clone, Ferret, N-Myc tag FG60106-NM

    14‑3‑3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    14‑3‑3 cDNA ORF Clone in Cloning Vector, Rat RG81525-G

    14‑3‑3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    14‑3‑3 cDNA ORF Clone in Cloning Vector, Mouse MG52938-G
    14‑3‑3 cDNA ORF Clone, Mouse, untagged MG52938-UT
    14‑3‑3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52938-ACG
    14‑3‑3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52938-ACGLN
    14‑3‑3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52938-ANG
    14‑3‑3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52938-ACR
    14‑3‑3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52938-ANR
    14‑3‑3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52938-CF
    14‑3‑3 cDNA ORF Clone, Mouse, C-His tag MG52938-CH
    14‑3‑3 cDNA ORF Clone, Mouse, N-His tag MG52938-NH
    14‑3‑3 cDNA ORF Clone, Mouse, C-HA tag MG52938-CY
    14‑3‑3 cDNA ORF Clone, Mouse, N-HA tag MG52938-NY
    14‑3‑3 cDNA ORF Clone, Mouse, C-Myc tag MG52938-CM
    14‑3‑3 cDNA ORF Clone, Mouse, N-Myc tag MG52938-NM

    14‑3‑3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    14‑3‑3 cDNA ORF Clone in Cloning Vector, Human HG10845-M
    14‑3‑3 cDNA ORF Clone, Human, untagged HG10845-UT
    14‑3‑3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10845-ACGLN
    14‑3‑3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10845-ACG
    14‑3‑3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10845-ANG
    14‑3‑3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10845-ACR
    14‑3‑3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10845-ANR
    14‑3‑3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10845-CF
    14‑3‑3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10845-NF
    14‑3‑3 cDNA ORF Clone, Human, C-His tag HG10845-CH
    14‑3‑3 cDNA ORF Clone, Human, N-His tag HG10845-NH
    14‑3‑3 cDNA ORF Clone, Human, C-HA tag HG10845-CY
    14‑3‑3 cDNA ORF Clone, Human, N-HA tag HG10845-NY
    14‑3‑3 cDNA ORF Clone, Human, C-Myc tag HG10845-CM
    14‑3‑3 cDNA ORF Clone, Human, N-Myc tag HG10845-NM
    14‑3‑3 qPCR Primer Pairs, Human HP100742
    info info
    添加购物车成功! 添加购物车失败!