ZCCHC17 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52592-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZCCHC17 Reagents
CRO Services
Product recommended

All ZCCHC17 Reagents
ZCCHC17 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
726 bp
Description
Full length Clone DNA of Mouse zinc finger, CCHC domain containing 17 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZCCHC17 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2810055E05Rik cDNA ORF Clone, Mouse;HSPC251 cDNA ORF Clone, Mouse;LDC4 cDNA ORF Clone, Mouse;pNO40 cDNA ORF Clone, Mouse;pS1D cDNA ORF Clone, Mouse
ZCCHC17 Background Information
Full Name
zinc finger, CCHC domain containing 17

ZCCHC17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZCCHC17 cDNA ORF Clone in Cloning Vector, Mouse MG52592-G
ZCCHC17 cDNA ORF Clone, Mouse, untagged MG52592-UT
ZCCHC17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52592-ACGLN
ZCCHC17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52592-ACG
ZCCHC17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52592-ACR
ZCCHC17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52592-CF
ZCCHC17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52592-NF
ZCCHC17 cDNA ORF Clone, Mouse, C-His tag MG52592-CH
ZCCHC17 cDNA ORF Clone, Mouse, N-His tag MG52592-NH
ZCCHC17 cDNA ORF Clone, Mouse, C-HA tag MG52592-CY
ZCCHC17 cDNA ORF Clone, Mouse, N-HA tag MG52592-NY
ZCCHC17 cDNA ORF Clone, Mouse, C-Myc tag MG52592-CM
ZCCHC17 qPCR Primer Pairs, Mouse MP202463

ZCCHC17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZCCHC17 cDNA ORF Clone in Cloning Vector, Human HG16966-U
ZCCHC17 cDNA ORF Clone, Human, untagged HG16966-UT
ZCCHC17 cDNA ORF Clone, Human, C-GFPSpark® tag HG16966-ACG
ZCCHC17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16966-ACGLN
ZCCHC17 cDNA ORF Clone, Human, N-GFPSpark® tag HG16966-ANG
ZCCHC17 cDNA ORF Clone, Human, C-OFPSpark® tag HG16966-ACR
ZCCHC17 cDNA ORF Clone, Human, N-OFPSpark® tag HG16966-ANR
ZCCHC17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16966-CF
ZCCHC17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16966-NF
ZCCHC17 cDNA ORF Clone, Human, C-His tag HG16966-CH
ZCCHC17 cDNA ORF Clone, Human, N-His tag HG16966-NH
ZCCHC17 cDNA ORF Clone, Human, C-HA tag HG16966-CY
ZCCHC17 cDNA ORF Clone, Human, N-HA tag HG16966-NY
ZCCHC17 cDNA ORF Clone, Human, C-Myc tag HG16966-CM
ZCCHC17 cDNA ORF Clone, Human, N-Myc tag HG16966-NM
info info
添加购物车成功! 添加购物车失败!