After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Human PHPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

데이터시트리뷰관련제품프로토콜
Human PHPT1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_014172.4
cDNA 크기:378
cDNA 설명:ORF Clone of Homo sapiens phosphohistidine phosphatase 1 DNA.
유전자 동의어:PHP14, CGI-202, HSPC141, bA216L13.10, RP11-216L13.10
:Human
벡터:pCMV/hygro
제한 사이트:KpnI + XhoI
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
보관:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
연구배경

PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.

참고자료
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • 이미지
    • Human PHPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".