ACADM/MCAD cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81147-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACADM/MCAD Reagents
CRO Services
Product recommended

All ACADM/MCAD Reagents
ACADM/MCAD cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1266 bp
Description
Full length Clone DNA of Rat acyl-CoA dehydrogenase, C-4 to C-12 straight chain with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADM/MCAD Background Information
Full Name
acyl-CoA dehydrogenase, C-4 to C-12 straight chain

ACADM/MCAD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Rat RG81147-U
ACADM/MCAD cDNA ORF Clone, Rat, untagged RG81147-UT
ACADM/MCAD cDNA ORF Clone, Rat, C-GFPSpark® tag RG81147-ACG
ACADM/MCAD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81147-ACGLN
ACADM/MCAD cDNA ORF Clone, Rat, N-GFPSpark® tag RG81147-ANG
ACADM/MCAD cDNA ORF Clone, Rat, C-OFPSpark® tag RG81147-ACR
ACADM/MCAD cDNA ORF Clone, Rat, N-OFPSpark® tag RG81147-ANR
ACADM/MCAD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81147-CF
ACADM/MCAD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81147-NF
ACADM/MCAD cDNA ORF Clone, Rat, C-His tag RG81147-CH
ACADM/MCAD cDNA ORF Clone, Rat, N-His tag RG81147-NH
ACADM/MCAD cDNA ORF Clone, Rat, C-HA tag RG81147-CY
ACADM/MCAD cDNA ORF Clone, Rat, N-HA tag RG81147-NY
ACADM/MCAD cDNA ORF Clone, Rat, N-Myc tag RG81147-NM
ACADM/MCAD qPCR Primer Pairs, Rat RP301103

ACADM/MCAD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Mouse MG51216-G
ACADM/MCAD cDNA ORF Clone, Mouse, untagged MG51216-UT
ACADM/MCAD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51216-ACGLN
ACADM/MCAD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51216-ACG
ACADM/MCAD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51216-ANG
ACADM/MCAD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51216-ACR
ACADM/MCAD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51216-ANR
ACADM/MCAD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51216-CF
ACADM/MCAD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51216-NF
ACADM/MCAD cDNA ORF Clone, Mouse, C-His tag MG51216-CH
ACADM/MCAD cDNA ORF Clone, Mouse, N-His tag MG51216-NH
ACADM/MCAD cDNA ORF Clone, Mouse, C-HA tag MG51216-CY
ACADM/MCAD cDNA ORF Clone, Mouse, N-HA tag MG51216-NY
ACADM/MCAD cDNA ORF Clone, Mouse, C-Myc tag MG51216-CM
ACADM/MCAD cDNA ORF Clone, Mouse, N-Myc tag MG51216-NM
ACADM/MCAD qPCR Primer Pairs, Mouse MP201100

ACADM/MCAD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADM/MCAD cDNA ORF Clone in Cloning Vector, Human HG14896-G
ACADM/MCAD cDNA ORF Clone, Human, untagged HG14896-UT
ACADM/MCAD cDNA ORF Clone, Human, C-GFPSpark® tag HG14896-ACG
ACADM/MCAD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14896-ACGLN
ACADM/MCAD cDNA ORF Clone, Human, N-GFPSpark® tag HG14896-ANG
ACADM/MCAD cDNA ORF Clone, Human, C-OFPSpark® tag HG14896-ACR
ACADM/MCAD cDNA ORF Clone, Human, N-OFPSpark® tag HG14896-ANR
ACADM/MCAD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14896-CF
ACADM/MCAD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14896-NF
ACADM/MCAD cDNA ORF Clone, Human, C-His tag HG14896-CH
ACADM/MCAD cDNA ORF Clone, Human, N-His tag HG14896-NH
ACADM/MCAD cDNA ORF Clone, Human, C-HA tag HG14896-CY
ACADM/MCAD cDNA ORF Clone, Human, N-HA tag HG14896-NY
ACADM/MCAD cDNA ORF Clone, Human, C-Myc tag HG14896-CM
ACADM/MCAD cDNA ORF Clone, Human, N-Myc tag HG14896-NM
ACADM/MCAD qPCR Primer Pairs, Human HP103525
info info
添加购物车成功! 添加购物车失败!