Arp2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80467-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Arp2 Reagents

CRO Services

Product recommended


All Arp2 Reagents

Arp2 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Description
Full length Clone DNA of Rat ARP2 actin-related protein 2 homolog (yeast) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arp2 Background Information

Full Name
ARP2 actin-related protein 2 homolog (yeast)

Arp2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Arp2 cDNA ORF Clone in Cloning Vector, Rat RG80467-U
Arp2 cDNA ORF Clone, Rat, untagged RG80467-UT
Arp2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80467-ACG
Arp2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80467-ACGLN
Arp2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80467-ANG
Arp2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80467-ACR
Arp2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80467-ANR
Arp2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80467-CF
Arp2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80467-NF
Arp2 cDNA ORF Clone, Rat, C-His tag RG80467-CH
Arp2 cDNA ORF Clone, Rat, N-His tag RG80467-NH
Arp2 cDNA ORF Clone, Rat, C-HA tag RG80467-CY
Arp2 cDNA ORF Clone, Rat, C-Myc tag RG80467-CM
Arp2 cDNA ORF Clone, Rat, N-Myc tag RG80467-NM
Arp2 qPCR Primer Pairs, Rat RP300431

Arp2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Arp2 cDNA ORF Clone in Cloning Vector, Mouse MG59715-U
Arp2 cDNA ORF Clone, Mouse, untagged MG59715-UT
Arp2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59715-ACGLN
Arp2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59715-ACG
Arp2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59715-ANG
Arp2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59715-ACR
Arp2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59715-ANR
Arp2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59715-CF
Arp2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59715-NF
Arp2 cDNA ORF Clone, Mouse, C-His tag MG59715-CH
Arp2 cDNA ORF Clone, Mouse, N-His tag MG59715-NH
Arp2 cDNA ORF Clone, Mouse, C-HA tag MG59715-CY
Arp2 cDNA ORF Clone, Mouse, N-HA tag MG59715-NY
Arp2 cDNA ORF Clone, Mouse, C-Myc tag MG59715-CM
Arp2 cDNA ORF Clone, Mouse, N-Myc tag MG59715-NM

Arp2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Arp2 cDNA ORF Clone in Cloning Vector, Human HG11546-M
Arp2 cDNA ORF Clone, Human, untagged HG11546-UT
Arp2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11546-ACG
Arp2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11546-ACGLN
Arp2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11546-ANG
Arp2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11546-ACR
Arp2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11546-ANR
Arp2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11546-CF
Arp2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11546-NF
Arp2 cDNA ORF Clone, Human, C-His tag HG11546-CH
Arp2 cDNA ORF Clone, Human, N-His tag HG11546-NH
Arp2 cDNA ORF Clone, Human, C-HA tag HG11546-CY
Arp2 cDNA ORF Clone, Human, N-HA tag HG11546-NY
Arp2 cDNA ORF Clone, Human, C-Myc tag HG11546-CM
Arp2 cDNA ORF Clone, Human, N-Myc tag HG11546-NM
Arp2 qPCR Primer Pairs, Human HP101414
info info
添加购物车成功! 添加购物车失败!