ADH1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81112-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ADH1 Reagents

CRO Services

Product recommended


All ADH1 Reagents

ADH1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Rat alcohol dehydrogenase 1 (class I) with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADH1 Background Information

Full Name
alcohol dehydrogenase 1 (class I)

ADH1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADH1 cDNA ORF Clone in Cloning Vector, Rat RG81112-U
ADH1 cDNA ORF Clone, Rat, untagged RG81112-UT
ADH1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81112-ACGLN
ADH1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81112-ACG
ADH1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81112-ANG
ADH1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81112-ACR
ADH1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81112-ANR
ADH1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81112-NF
ADH1 cDNA ORF Clone, Rat, C-His tag RG81112-CH
ADH1 cDNA ORF Clone, Rat, N-His tag RG81112-NH
ADH1 cDNA ORF Clone, Rat, C-HA tag RG81112-CY
ADH1 cDNA ORF Clone, Rat, N-HA tag RG81112-NY
ADH1 cDNA ORF Clone, Rat, C-Myc tag RG81112-CM
ADH1 cDNA ORF Clone, Rat, N-Myc tag RG81112-NM
ADH1 qPCR Primer Pairs, Rat RP301069

ADH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADH1 cDNA ORF Clone in Cloning Vector, Mouse MG53617-U
ADH1 cDNA ORF Clone, Mouse, untagged MG53617-UT
ADH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53617-ACG
ADH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53617-ACGLN
ADH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53617-ANG
ADH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53617-ACR
ADH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53617-ANR
ADH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53617-CF
ADH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53617-NF
ADH1 cDNA ORF Clone, Mouse, C-His tag MG53617-CH
ADH1 cDNA ORF Clone, Mouse, N-His tag MG53617-NH
ADH1 cDNA ORF Clone, Mouse, C-HA tag MG53617-CY
ADH1 cDNA ORF Clone, Mouse, N-HA tag MG53617-NY
ADH1 cDNA ORF Clone, Mouse, C-Myc tag MG53617-CM
ADH1 cDNA ORF Clone, Mouse, N-Myc tag MG53617-NM
info info
添加购物车成功! 添加购物车失败!