ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81336-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ADI1/MTCBP-1 Reagents

CRO Services

Product recommended


All ADI1/MTCBP-1 Reagents

ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
540 bp
Description
Full length Clone DNA of Rat acireductone dioxygenase 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADI1/MTCBP-1 Background Information

Full Name
acireductone dioxygenase 1

ADI1/MTCBP-1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADI1/MTCBP-1 cDNA ORF Clone in Cloning Vector, Rat RG81336-G
ADI1/MTCBP-1 cDNA ORF Clone, Rat, untagged RG81336-UT
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81336-ACG
ADI1/MTCBP-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81336-ACGLN
ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81336-ANG
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81336-ACR
ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81336-ANR
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81336-CF
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-His tag RG81336-CH
ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-His tag RG81336-NH
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-HA tag RG81336-CY
ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-HA tag RG81336-NY
ADI1/MTCBP-1 cDNA ORF Clone, Rat, C-Myc tag RG81336-CM
ADI1/MTCBP-1 cDNA ORF Clone, Rat, N-Myc tag RG81336-NM
ADI1/MTCBP-1 qPCR Primer Pairs, Rat RP301282

ADI1/MTCBP-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADI1/MTCBP-1 cDNA ORF Clone in Cloning Vector, Human HG21447-U
ADI1/MTCBP-1 cDNA ORF Clone, Human, untagged HG21447-UT
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG21447-ACG
ADI1/MTCBP-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21447-ACGLN
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-GFPSpark® tag HG21447-ANG
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG21447-ACR
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-OFPSpark® tag HG21447-ANR
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21447-CF
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21447-NF
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-His tag HG21447-CH
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-His tag HG21447-NH
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-HA tag HG21447-CY
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-HA tag HG21447-NY
ADI1/MTCBP-1 cDNA ORF Clone, Human, C-Myc tag HG21447-CM
ADI1/MTCBP-1 cDNA ORF Clone, Human, N-Myc tag HG21447-NM
info info
添加购物车成功! 添加购物车失败!