APOA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81118-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All APOA4 Reagents

CRO Services

Product recommended


All APOA4 Reagents

APOA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Rat apolipoprotein A-IV with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APOA4 Background Information

Full Name
apolipoprotein A-IV

APOA4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
APOA4 cDNA ORF Clone in Cloning Vector, Rat RG81118-U
APOA4 cDNA ORF Clone, Rat, untagged RG81118-UT
APOA4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81118-ACG
APOA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81118-ACGLN
APOA4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81118-ACR
APOA4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81118-NF
APOA4 cDNA ORF Clone, Rat, C-His tag RG81118-CH
APOA4 cDNA ORF Clone, Rat, N-His tag RG81118-NH
APOA4 cDNA ORF Clone, Rat, C-HA tag RG81118-CY
APOA4 cDNA ORF Clone, Rat, N-HA tag RG81118-NY
APOA4 cDNA ORF Clone, Rat, C-Myc tag RG81118-CM
APOA4 cDNA ORF Clone, Rat, N-Myc tag RG81118-NM
APOA4 qPCR Primer Pairs, Rat RP301075

APOA4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
APOA4 cDNA ORF Clone in Cloning Vector, Mouse MG58132-U
APOA4 cDNA ORF Clone, Mouse, untagged MG58132-UT
APOA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58132-ACG
APOA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58132-ACGLN
APOA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58132-ACR
APOA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58132-CF
APOA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58132-NF
APOA4 cDNA ORF Clone, Mouse, C-His tag MG58132-CH
APOA4 cDNA ORF Clone, Mouse, N-His tag MG58132-NH
APOA4 cDNA ORF Clone, Mouse, C-HA tag MG58132-CY
APOA4 cDNA ORF Clone, Mouse, N-HA tag MG58132-NY
APOA4 cDNA ORF Clone, Mouse, C-Myc tag MG58132-CM
APOA4 cDNA ORF Clone, Mouse, N-Myc tag MG58132-NM

APOA4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APOA4 cDNA ORF Clone in Cloning Vector, Human HG16082-G
APOA4 cDNA ORF Clone, Human, untagged HG16082-UT
APOA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16082-ACG
APOA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16082-ACGLN
APOA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16082-ACR
APOA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16082-CF
APOA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16082-NF
APOA4 cDNA ORF Clone, Human, C-His tag HG16082-CH
APOA4 cDNA ORF Clone, Human, N-His tag HG16082-NH
APOA4 cDNA ORF Clone, Human, C-HA tag HG16082-CY
APOA4 cDNA ORF Clone, Human, N-HA tag HG16082-NY
APOA4 cDNA ORF Clone, Human, C-Myc tag HG16082-CM
APOA4 cDNA ORF Clone, Human, N-Myc tag HG16082-NM
info info
添加购物车成功! 添加购物车失败!