D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80735-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All D4 GDI/ARHGDIB Reagents
CRO Services
Product recommended

All D4 GDI/ARHGDIB Reagents
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Rat Rho, GDP dissociation inhibitor (GDI) beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

D4 GDI/ARHGDIB Background Information
Full Name
Rho GDP dissociation inhibitor (GDI) beta

D4 GDI/ARHGDIB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
D4 GDI/ARHGDIB cDNA ORF Clone in Cloning Vector, Rat RG80735-U
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, untagged RG80735-UT
D4 GDI/ARHGDIB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80735-ACGLN
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80735-ACG
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80735-ANG
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80735-ACR
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80735-ANR
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80735-CF
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80735-NF
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-His tag RG80735-CH
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-His tag RG80735-NH
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-HA tag RG80735-CY
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, N-HA tag RG80735-NY
D4 GDI/ARHGDIB cDNA ORF Clone, Rat, C-Myc tag RG80735-CM
D4 GDI/ARHGDIB qPCR Primer Pairs, Rat RP300699

D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
D4 GDI/ARHGDIB cDNA ORF Clone in Cloning Vector, Mouse MG53849-U
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, untagged MG53849-UT
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53849-ACG
D4 GDI/ARHGDIB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53849-ACGLN
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53849-ANG
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53849-ACR
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53849-ANR
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53849-CF
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53849-NF
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-His tag MG53849-CH
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-His tag MG53849-NH
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-HA tag MG53849-CY
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-HA tag MG53849-NY
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, C-Myc tag MG53849-CM
D4 GDI/ARHGDIB cDNA ORF Clone, Mouse, N-Myc tag MG53849-NM

D4 GDI/ARHGDIB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
D4 GDI/ARHGDIB cDNA ORF Clone in Cloning Vector, Human HG16800-U
D4 GDI/ARHGDIB cDNA ORF Clone, Human, untagged HG16800-UT
D4 GDI/ARHGDIB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16800-ACGLN
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-GFPSpark® tag HG16800-ACG
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-GFPSpark® tag HG16800-ANG
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-OFPSpark® tag HG16800-ACR
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-OFPSpark® tag HG16800-ANR
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16800-CF
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16800-NF
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-His tag HG16800-CH
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-His tag HG16800-NH
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-HA tag HG16800-CY
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-HA tag HG16800-NY
D4 GDI/ARHGDIB cDNA ORF Clone, Human, C-Myc tag HG16800-CM
D4 GDI/ARHGDIB cDNA ORF Clone, Human, N-Myc tag HG16800-NM
info info
添加购物车成功! 添加购物车失败!