BHMT cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81129-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BHMT Reagents
CRO Services
Product recommended

All BHMT Reagents
BHMT cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Rat betaine-homocysteine S-methyltransferase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BHMT Background Information
Full Name
betaine--homocysteine S-methyltransferase

BHMT cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
BHMT cDNA ORF Clone in Cloning Vector, Canine DG70175-U
BHMT cDNA ORF Clone, Canine, untagged DG70175-UT
BHMT cDNA ORF Clone, Canine, C-GFPSpark® tag DG70175-ACG
BHMT Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70175-ACGLN
BHMT cDNA ORF Clone, Canine, N-GFPSpark® tag DG70175-ANG
BHMT cDNA ORF Clone, Canine, C-OFPSpark® tag DG70175-ACR
BHMT cDNA ORF Clone, Canine, N-OFPSpark® tag DG70175-ANR
BHMT cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70175-CF
BHMT cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70175-NF
BHMT cDNA ORF Clone, Canine, C-His tag DG70175-CH
BHMT cDNA ORF Clone, Canine, N-His tag DG70175-NH
BHMT cDNA ORF Clone, Canine, C-HA tag DG70175-CY
BHMT cDNA ORF Clone, Canine, N-HA tag DG70175-NY
BHMT cDNA ORF Clone, Canine, C-Myc tag DG70175-CM
BHMT cDNA ORF Clone, Canine, N-Myc tag DG70175-NM

BHMT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BHMT cDNA ORF Clone in Cloning Vector, Rat RG81129-U
BHMT cDNA ORF Clone, Rat, untagged RG81129-UT
BHMT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81129-ACGLN
BHMT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81129-ACG
BHMT cDNA ORF Clone, Rat, N-GFPSpark® tag RG81129-ANG
BHMT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81129-ACR
BHMT cDNA ORF Clone, Rat, N-OFPSpark® tag RG81129-ANR
BHMT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81129-NF
BHMT cDNA ORF Clone, Rat, C-His tag RG81129-CH
BHMT cDNA ORF Clone, Rat, N-His tag RG81129-NH
BHMT cDNA ORF Clone, Rat, C-HA tag RG81129-CY
BHMT cDNA ORF Clone, Rat, N-HA tag RG81129-NY
BHMT cDNA ORF Clone, Rat, C-Myc tag RG81129-CM
BHMT cDNA ORF Clone, Rat, N-Myc tag RG81129-NM
BHMT qPCR Primer Pairs, Rat RP301086

BHMT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BHMT cDNA ORF Clone, Human, untagged HG12459-G-N
BHMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12459-ACGLN
BHMT qPCR Primer Pairs, Human HP104793
info info
添加购物车成功! 添加购物车失败!