CD151 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80437-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD151 Reagents

CRO Services

Product recommended


All CD151 Reagents

CD151 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
762 bp
Description
Full length Clone DNA of Rat CD151 molecule (Raph blood group) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD151 Background Information

Full Name
CD151 molecule (Raph blood group)

CD151 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
CD151 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90749-G
CD151 cDNA ORF Clone, Cynomolgus, untagged CG90749-UT
CD151 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90749-ACGLN
CD151 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90749-ACG
CD151 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90749-ACR
CD151 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90749-CF
CD151 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90749-NF
CD151 cDNA ORF Clone, Cynomolgus, C-His tag CG90749-CH
CD151 cDNA ORF Clone, Cynomolgus, N-His tag CG90749-NH
CD151 cDNA ORF Clone, Cynomolgus, C-HA tag CG90749-CY
CD151 cDNA ORF Clone, Cynomolgus, N-HA tag CG90749-NY
CD151 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90749-CM
CD151 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90749-NM

CD151 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD151 cDNA ORF Clone in Cloning Vector, Rat RG80437-G
CD151 cDNA ORF Clone, Rat, untagged RG80437-UT
CD151 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80437-ACG
CD151 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80437-ACGLN
CD151 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80437-ACR
CD151 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80437-CF
CD151 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80437-NF
CD151 cDNA ORF Clone, Rat, C-His tag RG80437-CH
CD151 cDNA ORF Clone, Rat, N-His tag RG80437-NH
CD151 cDNA ORF Clone, Rat, C-HA tag RG80437-CY
CD151 cDNA ORF Clone, Rat, C-Myc tag RG80437-CM
CD151 cDNA ORF Clone, Rat, N-Myc tag RG80437-NM
CD151 qPCR Primer Pairs, Rat RP300409

CD151 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD151 cDNA ORF Clone in Cloning Vector, Mouse MG50809-G
CD151 cDNA ORF Clone, Mouse, untagged MG50809-UT
CD151 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50809-ACGLN
CD151 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50809-ACG
CD151 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50809-ACR
CD151 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50809-CF
CD151 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50809-NF
CD151 cDNA ORF Clone, Mouse, C-His tag MG50809-CH
CD151 cDNA ORF Clone, Mouse, N-His tag MG50809-NH
CD151 cDNA ORF Clone, Mouse, C-HA tag MG50809-CY
CD151 cDNA ORF Clone, Mouse, N-HA tag MG50809-NY
CD151 cDNA ORF Clone, Mouse, C-Myc tag MG50809-CM
CD151 cDNA ORF Clone, Mouse, N-Myc tag MG50809-NM
CD151 qPCR Primer Pairs, Mouse MP200780

CD151 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD151 cDNA ORF Clone in Cloning Vector, Human HG13651-G
CD151 cDNA ORF Clone, Human, untagged HG13651-UT
CD151 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13651-ACGLN
CD151 cDNA ORF Clone, Human, C-GFPSpark® tag HG13651-ACG
CD151 cDNA ORF Clone, Human, N-GFPSpark® tag HG13651-ANG
CD151 cDNA ORF Clone, Human, C-OFPSpark® tag HG13651-ACR
CD151 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13651-CF
CD151 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13651-NF
CD151 cDNA ORF Clone, Human, C-His tag HG13651-CH
CD151 cDNA ORF Clone, Human, N-His tag HG13651-NH
CD151 cDNA ORF Clone, Human, C-HA tag HG13651-CY
CD151 cDNA ORF Clone, Human, N-HA tag HG13651-NY
CD151 cDNA ORF Clone, Human, C-Myc tag HG13651-CM
CD151 cDNA ORF Clone, Human, N-Myc tag HG13651-NM
CD151 qPCR Primer Pairs, Human HP102334
info info
添加购物车成功! 添加购物车失败!