쥐 CD164 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
     CD164 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_031812.1
    cDNA 크기:588bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus CD164 molecule, sialomucin with C terminal HA tag.
    유전자 동의어:MGC-24v, Cd164
    :Rat
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD164 qPCR primers for gene expression analysis, RP300324 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    Sialomucin core protein 24 also known as endolyn or CD164 (cluster of differentiation 164) is a novel 80- to 90-kD mucin-like molecule expressed by human CD34+ hematopoietic progenitor cells. Isoform 1 and isoform 3 of CD164 are expressed in hematopoietic and non-hematopoietic tissues. Isoform 1 is expressed by prostate cancer tumors and prostate cancer cell lines. The expression is greater in bone metastases than in primary tumors. Expression in osseous metastasis is greater than that in soft tissue metastasis. Isoform 2 of CD164 is expressed in the small intestine, colon, lung, thyroid and in colorectal and pancreatic adenocarcinoma. Isoform 4 is expressed by both hematopoietic progenitor cells and bone marrow stromal cells. CD164 belongs to the CD164 family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. CD164 may play an important role in prostate cancer metastasis and the infiltration of bone marrow by cancer cells. CD164 promotes myogenesis by enhancing CXCR4-dependent cell motility. This protein positively regulates myoblast migration and promotes myoblast fusion into myotubes. CD164 may play a key role in hematopoiesis by facilitating the adhesion of CD34+ cells to bone marrow stroma and by negatively regulating CD34+hematopoietic progenitor cell growth.

    참고자료
  • McGuckin CP, et al. (2003) Colocalization analysis of sialomucins CD34 and CD164. Stem Cells. 21(2): 162-70.
  • Doyonnas R, et al. (2000) CD164 monoclonal antibodies that block hemopoietic progenitor cell adhesion and proliferation interact with the first mucin domain of the CD164 receptor. J Immunol. 165(2): 840-51.
  • Zannettino AC, et al. (1998) The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal cells that serves as a potent negative regulator of hematopoiesis. Blood. 92(8): 2613-28.
  • Size / Price
    Cat No: RG80354-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".