CD1d1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80287-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD1d1 Reagents

CRO Services

Product recommended


All CD1d1 Reagents

CD1d1 cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Description
Full length Clone DNA of Rat CD1d1 molecule with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD1d1 Background Information

Full Name
CD1d1 antigen

CD1d1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD1d1 cDNA ORF Clone in Cloning Vector, Rat RG80287-G
CD1d1 cDNA ORF Clone, Rat, untagged RG80287-UT
CD1d1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80287-ACGLN
CD1d1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80287-ACG
CD1d1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80287-ACR
CD1d1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80287-CF
CD1d1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80287-NF
CD1d1 cDNA ORF Clone, Rat, C-His tag RG80287-CH
CD1d1 cDNA ORF Clone, Rat, C-HA tag RG80287-CY
CD1d1 cDNA ORF Clone, Rat, N-HA tag RG80287-NY
CD1d1 cDNA ORF Clone, Rat, C-Myc tag RG80287-CM
CD1d1 cDNA ORF Clone, Rat, N-Myc tag RG80287-NM
CD1d1 qPCR Primer Pairs, Rat RP300265

CD1d1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD1d1 cDNA ORF Clone in Cloning Vector, Mouse MG50188-M
CD1d1 cDNA ORF Clone, Mouse, untagged MG50188-UT
CD1d1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50188-ACG
CD1d1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50188-ACGLN
CD1d1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50188-ACR
CD1d1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50188-CF
CD1d1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50188-NF
CD1d1 cDNA ORF Clone, Mouse, C-His tag MG50188-CH
CD1d1 cDNA ORF Clone, Mouse, N-His tag MG50188-NH
CD1d1 cDNA ORF Clone, Mouse, C-HA tag MG50188-CY
CD1d1 cDNA ORF Clone, Mouse, N-HA tag MG50188-NY
CD1d1 cDNA ORF Clone, Mouse, C-Myc tag MG50188-CM
CD1d1 cDNA ORF Clone, Mouse, N-Myc tag MG50188-NM
CD1d1 qPCR Primer Pairs, Mouse MP200218
info info
添加购物车成功! 添加购物车失败!