After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CD3d/CD3 delta Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Rat CD3D cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013169.1
cDNA 크기:522bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus CD3 molecule, delta with C terminal HA tag.
유전자 동의어:Cd3d
:Rat
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

T-cell surface glycoprotein CD3 delta chain, also known as CD3D, is a single-pass type I membrane protein. CD3D, together with CD3-gamma, CD3-epsilon and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The majority of T cell receptor (TCR) complexes in mice and humans consist of a heterodimer of polymorphic TCRalpha and beta chains along with invariant CD3gamma, delta, epsilon, and zeta chains. CD3 chains are present as CD3gammaepsilon, deltaepsilon, and zetazeta dimers in the receptor complex and play critical roles in the antigen receptor assembly, transport to the cell surface, and the receptor-mediated signal transduction. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. The T cell receptor-CD3 complex is unique in having ten cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs). CD3D contains 1 ITAM domain and has been shown to interact with CD8A. In the mouse, knockout of CD3delta allows some degree of T lymphocyte differentiation since mature CD4 and CD8 as well as TCRgammadelta T lymphocytes are observed in the periphery. In contrast, deleterious mutation of the CD3delta encoding gene in the human leads to a severe combined immunodeficiency characterised by the complete absence of mature T cell subpopulations including TCRalpha/beta and TCRgamma/delta. Defects in CD3D cause severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (T-/B+/NK+ SCID) which is a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. In humans the absence of CD3 delta results in a complete arrest in thymocyte development at the stage of double negative to double positive transition and the development of gamma delta T-cell receptor-positive T cells is also impaired.

참고자료
  • Roifman CM. (2004) CD3 delta immunodeficiency. Curr Opin Allergy Clin Immunol. 4(6): 479-84.
  • Pan Q, et al. (2006) Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol. 43(11): 1741-50.
  • Le Deist F, et al. (2007) Expression anomalies of the CD3-TCR complex expression and immunodeficiencies. Med Sci (Paris). 23(2): 161-6.
  • Size / Price
    Cat No: RG80313-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".