쥐 CD3g/CD3 gamma Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     CD3G cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001077646.1
    cDNA 크기:549bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus CD3 molecule, gamma with N terminal His tag.
    유전자 동의어:Cd3g
    :Rat
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD3G qPCR primers for gene expression analysis, RP300287 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    참고자료
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".