CD47 cDNA ORF Clone, Rat, N-His tag

Cat: RG80305-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD47 Reagents
CRO Services
Product recommended

All CD47 Reagents
CD47 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Rat Cd47 molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD47 Background Information

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD47 molecule
References
  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • CD47 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD47 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90869-G

    CD47 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD47 cDNA ORF Clone in Cloning Vector, Rat RG80305-G
    CD47 cDNA ORF Clone, Rat, untagged RG80305-UT
    CD47 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80305-ACGLN
    CD47 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80305-ACG
    CD47 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80305-ACR
    CD47 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80305-CF
    CD47 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80305-NF
    CD47 cDNA ORF Clone, Rat, C-His tag RG80305-CH
    CD47 cDNA ORF Clone, Rat, C-HA tag RG80305-CY
    CD47 cDNA ORF Clone, Rat, N-HA tag RG80305-NY
    CD47 cDNA ORF Clone, Rat, C-Myc tag RG80305-CM
    CD47 cDNA ORF Clone, Rat, N-Myc tag RG80305-NM
    CD47 qPCR Primer Pairs, Rat RP300281

    CD47 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD47 cDNA ORF Clone, Mouse, untagged MG57231-UT
    CD47 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57231-ACG
    CD47 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57231-ACGLN
    CD47 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57231-ACR
    CD47 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57231-CF
    CD47 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57231-NF
    CD47 cDNA ORF Clone, Mouse, C-His tag MG57231-CH
    CD47 cDNA ORF Clone, Mouse, N-His tag MG57231-NH
    CD47 cDNA ORF Clone, Mouse, C-HA tag MG57231-CY
    CD47 cDNA ORF Clone, Mouse, N-HA tag MG57231-NY
    CD47 cDNA ORF Clone, Mouse, C-Myc tag MG57231-CM
    CD47 cDNA ORF Clone, Mouse, N-Myc tag MG57231-NM

    CD47 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD47 cDNA ORF Clone in Cloning Vector, Human HG29612-G
    CD47 cDNA ORF Clone in Cloning Vector, Human HG12283-G
    CD47 cDNA ORF Clone, Human, untagged HG12283-UT
    CD47 cDNA ORF Clone, Human, untagged HG29612-UT
    CD47 cDNA ORF Clone, Human, C-GFPSpark® tag HG29612-ACG
    CD47 cDNA ORF Clone, Human, C-GFPSpark® tag HG12283-ACG
    CD47 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12283-ACGLN
    CD47 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29612-ACGLN
    CD47 cDNA ORF Clone, Human, C-OFPSpark® tag HG29612-ACR
    CD47 cDNA ORF Clone, Human, C-OFPSpark® tag HG12283-ACR
    CD47 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12283-CF
    CD47 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29612-CF
    CD47 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29612-NF
    CD47 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12283-NF
    CD47 cDNA ORF Clone, Human, C-His tag HG29612-CH
    CD47 cDNA ORF Clone, Human, C-His tag HG12283-CH
    CD47 cDNA ORF Clone, Human, N-His tag HG29612-NH
    CD47 cDNA ORF Clone, Human, N-His tag HG12283-NH
    CD47 cDNA ORF Clone, Human, C-HA tag HG29612-CY
    CD47 cDNA ORF Clone, Human, C-HA tag HG12283-CY
    CD47 cDNA ORF Clone, Human, N-HA tag HG12283-NY
    CD47 cDNA ORF Clone, Human, N-HA tag HG29612-NY
    CD47 cDNA ORF Clone, Human, C-Myc tag HG12283-CM
    CD47 cDNA ORF Clone, Human, C-Myc tag HG29612-CM
    CD47 cDNA ORF Clone, Human, N-Myc tag HG12283-NM
    CD47 cDNA ORF Clone, Human, N-Myc tag HG29612-NM
    CD47 qPCR Primer Pairs, Human HP101891
    info info
    添加购物车成功! 添加购物车失败!