CD48 cDNA ORF Clone, Rat, C-His tag

Cat: RG80286-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD48 Reagents

CRO Services

Product recommended


All CD48 Reagents

CD48 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Rat Cd48 molecule with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD48 Background Information

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD48 molecule
References
  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • CD48 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD48 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90661-G
    CD48 cDNA ORF Clone, Cynomolgus, untagged CG90661-UT
    CD48 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90661-ACGLN
    CD48 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90661-ACG
    CD48 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90661-ACR
    CD48 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90661-CF
    CD48 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90661-NF
    CD48 cDNA ORF Clone, Cynomolgus, C-His tag CG90661-CH
    CD48 cDNA ORF Clone, Cynomolgus, N-His tag CG90661-NH
    CD48 cDNA ORF Clone, Cynomolgus, C-HA tag CG90661-CY
    CD48 cDNA ORF Clone, Cynomolgus, N-HA tag CG90661-NY
    CD48 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90661-CM
    CD48 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90661-NM

    CD48 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD48 cDNA ORF Clone in Cloning Vector, Rat RG80286-G
    CD48 cDNA ORF Clone, Rat, untagged RG80286-UT
    CD48 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80286-ACGLN
    CD48 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80286-ACG
    CD48 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80286-ACR
    CD48 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80286-CF
    CD48 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80286-NF
    CD48 cDNA ORF Clone, Rat, N-His tag RG80286-NH
    CD48 cDNA ORF Clone, Rat, C-HA tag RG80286-CY
    CD48 cDNA ORF Clone, Rat, N-HA tag RG80286-NY
    CD48 cDNA ORF Clone, Rat, C-Myc tag RG80286-CM
    CD48 cDNA ORF Clone, Rat, N-Myc tag RG80286-NM
    CD48 qPCR Primer Pairs, Rat RP300264

    CD48 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD48 cDNA ORF Clone in Cloning Vector, Mouse MG50415-M
    CD48 cDNA ORF Clone, Mouse, untagged MG50415-UT
    CD48 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50415-ACGLN
    CD48 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50415-ACG
    CD48 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50415-ACR
    CD48 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50415-CF
    CD48 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50415-NF
    CD48 cDNA ORF Clone, Mouse, C-His tag MG50415-CH
    CD48 cDNA ORF Clone, Mouse, N-His tag MG50415-NH
    CD48 cDNA ORF Clone, Mouse, C-HA tag MG50415-CY
    CD48 cDNA ORF Clone, Mouse, N-HA tag MG50415-NY
    CD48 cDNA ORF Clone, Mouse, C-Myc tag MG50415-CM
    CD48 cDNA ORF Clone, Mouse, N-Myc tag MG50415-NM
    CD48 qPCR Primer Pairs, Mouse MP200428

    CD48 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD48 cDNA ORF Clone in Cloning Vector, Human HG10797-M
    CD48 cDNA ORF Clone, Human, untagged HG10797-UT
    CD48 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10797-ACGLN
    CD48 cDNA ORF Clone, Human, C-GFPSpark® tag HG10797-ACG
    CD48 cDNA ORF Clone, Human, C-OFPSpark® tag HG10797-ACR
    CD48 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10797-CF
    CD48 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10797-NF
    CD48 cDNA ORF Clone, Human, C-His tag HG10797-CH
    CD48 cDNA ORF Clone, Human, N-His tag HG10797-NH
    CD48 cDNA ORF Clone, Human, C-HA tag HG10797-CY
    CD48 cDNA ORF Clone, Human, N-HA tag HG10797-NY
    CD48 cDNA ORF Clone, Human, C-Myc tag HG10797-CM
    CD48 cDNA ORF Clone, Human, N-Myc tag HG10797-NM
    CD48 qPCR Primer Pairs, Human HP100711
    info info
    添加购物车成功! 添加购物车失败!