Text Size:AAA

쥐 CD52 / CDW52 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
 CD52 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_053983.1
cDNA 크기:291bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus CD52 antigen with N terminal His tag.
유전자 동의어:B7, Cd52
:Rat
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CD52 qPCR primers for gene expression analysis, RP300274 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
  • Size / Price
    Cat No: RG80298-NH
    정가: 
    가격:      (You Save: )
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".