CD52 cDNA ORF Clone, Rat, N-His tag

Cat: RG80298-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD52 Reagents

CRO Services

Product recommended


All CD52 Reagents

CD52 cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
291 bp
Description
Full length Clone DNA of Rat CD52 antigen with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD52 Background Information

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD52 molecule
References
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
  • CD52 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD52 cDNA ORF Clone in Cloning Vector, Rhesus CG90187-G
    CD52 cDNA ORF Clone, Rhesus, untagged CG90187-UT
    CD52 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90187-ACGLN
    CD52 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90187-ACG
    CD52 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90187-ACR
    CD52 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90187-CF
    CD52 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90187-NF
    CD52 cDNA ORF Clone, Rhesus, C-His tag CG90187-CH
    CD52 cDNA ORF Clone, Rhesus, N-His tag CG90187-NH
    CD52 cDNA ORF Clone, Rhesus, C-HA tag CG90187-CY
    CD52 cDNA ORF Clone, Rhesus, N-HA tag CG90187-NY
    CD52 cDNA ORF Clone, Rhesus, C-Myc tag CG90187-CM
    CD52 cDNA ORF Clone, Rhesus, N-Myc tag CG90187-NM

    CD52 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD52 cDNA ORF Clone in Cloning Vector, Rat RG80298-G
    CD52 cDNA ORF Clone, Rat, untagged RG80298-UT
    CD52 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80298-ACGLN
    CD52 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80298-ACG
    CD52 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80298-ACR
    CD52 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80298-CF
    CD52 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80298-NF
    CD52 cDNA ORF Clone, Rat, C-His tag RG80298-CH
    CD52 cDNA ORF Clone, Rat, C-HA tag RG80298-CY
    CD52 cDNA ORF Clone, Rat, N-HA tag RG80298-NY
    CD52 cDNA ORF Clone, Rat, C-Myc tag RG80298-CM
    CD52 cDNA ORF Clone, Rat, N-Myc tag RG80298-NM
    CD52 qPCR Primer Pairs, Rat RP300274

    CD52 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD52 cDNA ORF Clone in Cloning Vector, Mouse MG50721-G
    CD52 cDNA ORF Clone, Mouse, untagged MG50721-UT
    CD52 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50721-ACG
    CD52 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50721-ACGLN
    CD52 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50721-ACR
    CD52 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50721-CF
    CD52 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50721-NF
    CD52 cDNA ORF Clone, Mouse, C-His tag MG50721-CH
    CD52 cDNA ORF Clone, Mouse, N-His tag MG50721-NH
    CD52 cDNA ORF Clone, Mouse, C-HA tag MG50721-CY
    CD52 cDNA ORF Clone, Mouse, N-HA tag MG50721-NY
    CD52 cDNA ORF Clone, Mouse, C-Myc tag MG50721-CM
    CD52 cDNA ORF Clone, Mouse, N-Myc tag MG50721-NM
    CD52 qPCR Primer Pairs, Mouse MP200696

    CD52 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD52 cDNA ORF Clone in Cloning Vector, Human HG15105-G
    CD52 cDNA ORF Clone, Human, untagged HG15105-UT
    CD52 cDNA ORF Clone, Human, C-GFPSpark® tag HG15105-ACG
    CD52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15105-ACGLN
    CD52 cDNA ORF Clone, Human, C-OFPSpark® tag HG15105-ACR
    CD52 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15105-CF
    CD52 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15105-NF
    CD52 cDNA ORF Clone, Human, C-His tag HG15105-CH
    CD52 cDNA ORF Clone, Human, N-His tag HG15105-NH
    CD52 cDNA ORF Clone, Human, C-HA tag HG15105-CY
    CD52 cDNA ORF Clone, Human, N-HA tag HG15105-NY
    CD52 cDNA ORF Clone, Human, C-Myc tag HG15105-CM
    CD52 cDNA ORF Clone, Human, N-Myc tag HG15105-NM
    CD52 qPCR Primer Pairs, Human HP103732
    info info
    添加购物车成功! 添加购物车失败!