쥐 CD63 Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
     CD63 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_017125.3
    cDNA 크기:717bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus Cd63 molecule with N terminal His tag.
    유전자 동의어:MGC72893, Cd63
    :Rat
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD63 qPCR primers for gene expression analysis, RP300280 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    연구배경

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 63 (CD63) is a member of the CD family and the transmembrane 4 superfamily,also known as the tetraspanin family. CD63 is a cellular surface glycoprotein characterized by the presence of four bydrophobic domains. CD63 had functions in mediating signal transduction processes and then regulate variety of cellular processes such as cell proliferation, activation and motility. It has reported that CD63 protein associated with tumor progression and served as a blood platlet activation marker and the deficiency of this protein may be associated with Hermansky-Pudlak syndrome.

    참고자료
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Radford KJ, et al. (1996) Associates with Transmembrane 4 Superfamily Members, CD9 and CD81, and with beta 1 Integrins in Human Melanoma. Biochemical Biophysical Research Communications. 222(1): 13-18.
  • Metzelaar MJ, et al. (1991) CD63 antigen, A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. The journal of biological chemistry. 266: 3239-45.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".