After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 CD96/TACTILE Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Rat CD96 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001025032.1
cDNA 크기:1812bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus CD96 molecule with N terminal His tag.
유전자 동의어:Cd96
:Rat
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD155 ligand CD96 is a member of the Ig superfamily. It's a immunoglobulin-like protein tentatively allocated to the repertoire of human NK receptors. NK cells recognize poliovirus receptor (PVR), a nectins and nectin-like protein family member serve to mediate cell-cell adhesion, cell migration, with the presence of an additional receptor, CD96. CD96 promotes NK cell adhesion to target cells expressing PVR, stimulates cytotoxicity of activated NK cells, and mediates acquisition of PVR from target cells. The effect the cells with mutated CD96 protein lost adhesion and growth activities indicates that CD96 mutations may cause a form of the C syndrome by interfering with cell adhesion and growth.

참고자료
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Anja Fuchs, et al. (2004) Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155). The Journal of Immunology.172 (7): 3994-8.
  • Seth S, et al.(2007) The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochemical and Biophysical Research Communications. 364 (4): 959-65.
  • Size / Price
    Cat No: RG80338-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".