After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 Complement Factor H Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Rat CFH cDNA 클론 제품 정보
Gene_bank_ref_id:BC089845.1
cDNA 크기:1182bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus complement factor H.
유전자 동의어:Fh
:Rat
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

Complement factor H, also known as H factor 1, and CFH, is a sialic acid containing glycoprotein that plays an integral role in the regulation of the complement-mediated immune system that is involved in microbial defense, immune complex processing, and programmed cell death. Factor H protects host cells from injury resulting from unrestrained complement activation. CFH regulates complement activation on self cells by possessing both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3 convertase, C3bBb. CFH protects self cells from complement activation but not bacteria/viruses. Due to the central role that CFH plays in the regulation of complement, there are many clinical implications arrising from aberrant CFH activity. Mutations in the Factor H gene are associated with severe and diverse diseases including the rare renal disorders hemolytic uremic syndrome (HUS) and membranoproliferative glomerulonephritis (MPGN) also termed dense deposit disease (DDD), membranoproliferative glomuleronephritis type II or dense deposit disease, as well as the more frequent retinal disease age related macular degeneration (AMD). In addition to its complement regulatory activities, factor H has multiple physiological activities and 1) acts as an extracellular matrix component, 2) binds to cellular receptors of the integrin type, and 3) interacts with a wide selection of ligands, such as the C-reactive protein, thrombospondin, bone sialoprotein, osteopontin, and heparin.

참고자료
  • Zipfel PF. (2001) Complement factor H: physiology and pathophysiology. Semin Thromb Hemost. 27(3): 191-9.
  • Zipfel PF, et al. (2008) The complement fitness factor H: role in human diseases and for immune escape of pathogens, like pneumococci. Vaccine. 26 Suppl 8: I67-74.
  • Ferreira VP, et al. (2010) Complement control protein factor H: the good, the bad, and the inadequate. Mol Immunol. 47(13): 2187-97.
  • Donoso LA, et al. (2010) The role of complement Factor H in age-related macular degeneration: a review. Surv Ophthalmol. 55(3): 227-46.
  • Size / Price
    Cat No: RG81017-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".