CH25H cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81333-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CH25H Reagents

CRO Services

Product recommended


All CH25H Reagents

CH25H cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rat cholesterol 25-hydroxylase with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CH25H Background Information

Full Name
cholesterol 25-hydroxylase

CH25H cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CH25H cDNA ORF Clone in Cloning Vector, Rat RG81333-G
CH25H cDNA ORF Clone, Rat, untagged RG81333-UT
CH25H Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81333-ACGLN
CH25H cDNA ORF Clone, Rat, C-GFPSpark® tag RG81333-ACG
CH25H cDNA ORF Clone, Rat, N-GFPSpark® tag RG81333-ANG
CH25H cDNA ORF Clone, Rat, C-OFPSpark® tag RG81333-ACR
CH25H cDNA ORF Clone, Rat, N-OFPSpark® tag RG81333-ANR
CH25H cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81333-CF
CH25H cDNA ORF Clone, Rat, C-His tag RG81333-CH
CH25H cDNA ORF Clone, Rat, N-His tag RG81333-NH
CH25H cDNA ORF Clone, Rat, C-HA tag RG81333-CY
CH25H cDNA ORF Clone, Rat, N-HA tag RG81333-NY
CH25H cDNA ORF Clone, Rat, C-Myc tag RG81333-CM
CH25H cDNA ORF Clone, Rat, N-Myc tag RG81333-NM
CH25H qPCR Primer Pairs, Rat RP301279

CH25H cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CH25H cDNA ORF Clone in Cloning Vector, Human HG11501-M
CH25H cDNA ORF Clone, Human, untagged HG11501-UT
CH25H cDNA ORF Clone, Human, C-GFPSpark® tag HG11501-ACG
CH25H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11501-ACGLN
CH25H cDNA ORF Clone, Human, N-GFPSpark® tag HG11501-ANG
CH25H cDNA ORF Clone, Human, C-OFPSpark® tag HG11501-ACR
CH25H cDNA ORF Clone, Human, N-OFPSpark® tag HG11501-ANR
CH25H cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11501-CF
CH25H cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11501-NF
CH25H cDNA ORF Clone, Human, C-His tag HG11501-CH
CH25H cDNA ORF Clone, Human, N-His tag HG11501-NH
CH25H cDNA ORF Clone, Human, C-HA tag HG11501-CY
CH25H cDNA ORF Clone, Human, N-HA tag HG11501-NY
CH25H cDNA ORF Clone, Human, C-Myc tag HG11501-CM
CH25H cDNA ORF Clone, Human, N-Myc tag HG11501-NM
CH25H qPCR Primer Pairs, Human HP101376
info info
添加购物车成功! 添加购物车失败!