After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CLPS / Colipase Gene ORF cDNA clone expression plasmid, N-Myc 태그

데이터시트리뷰관련제품프로토콜
Rat CLPS cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013139.1
cDNA 크기:339bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus colipase, pancreatic with N terminal Myc tag.
유전자 동의어:COLQ
:Rat
벡터:pCMV3-SP-N-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.

참고자료
  • Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.
  • Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.
  • Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.
  • Size / Price
    Cat No: RG80729-NM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".