쥐 CTHRC1 Gene ORF cDNA clone expression plasmid, N-Myc 태그

    데이터시트리뷰관련제품프로토콜
     CTHRC1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001271300.1
    cDNA 크기:693bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus collagen triple helix repeat containing 1 with N terminal Myc tag.
    유전자 동의어:Cthrc1
    :Rat
    벡터:pCMV3-SP-N-Myc
    Plasmid:
    제한 사이트:
    태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTHRC1 qPCR primers for gene expression analysis, RP300676 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    연구배경

    Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

    참고자료
  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Cat No: RG80712-NM
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".