DAD1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80700-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DAD1 Reagents

CRO Services

Product recommended


All DAD1 Reagents

DAD1 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
342 bp
Description
Full length Clone DNA of Rat defender against cell death 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DAD1 Background Information

Full Name
defender against cell death 1

DAD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DAD1 cDNA ORF Clone in Cloning Vector, Rat RG80700-U
DAD1 cDNA ORF Clone, Rat, untagged RG80700-UT
DAD1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80700-ACGLN
DAD1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80700-ACG
DAD1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80700-ACR
DAD1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80700-CF
DAD1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80700-NF
DAD1 cDNA ORF Clone, Rat, C-His tag RG80700-CH
DAD1 cDNA ORF Clone, Rat, N-His tag RG80700-NH
DAD1 cDNA ORF Clone, Rat, C-HA tag RG80700-CY
DAD1 cDNA ORF Clone, Rat, N-HA tag RG80700-NY
DAD1 cDNA ORF Clone, Rat, C-Myc tag RG80700-CM
DAD1 qPCR Primer Pairs, Rat RP300664

DAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DAD1 cDNA ORF Clone in Cloning Vector, Mouse MG53860-U
DAD1 cDNA ORF Clone, Mouse, untagged MG53860-UT
DAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53860-ACGLN
DAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53860-ACG
DAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53860-ACR
DAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53860-CF
DAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53860-NF
DAD1 cDNA ORF Clone, Mouse, C-His tag MG53860-CH
DAD1 cDNA ORF Clone, Mouse, N-His tag MG53860-NH
DAD1 cDNA ORF Clone, Mouse, C-HA tag MG53860-CY
DAD1 cDNA ORF Clone, Mouse, N-HA tag MG53860-NY
DAD1 cDNA ORF Clone, Mouse, C-Myc tag MG53860-CM
DAD1 cDNA ORF Clone, Mouse, N-Myc tag MG53860-NM

DAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DAD1 cDNA ORF Clone in Cloning Vector, Human HG20679-U
info info
添加购物车成功! 添加购物车失败!