DCTN3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81338-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DCTN3 Reagents

CRO Services

Product recommended


All DCTN3 Reagents

DCTN3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
561 bp
Description
Full length Clone DNA of Rat dynactin 3 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN3 Background Information

Full Name
dynactin 3 (p22)

DCTN3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Rat RG81338-G
DCTN3 cDNA ORF Clone, Rat, untagged RG81338-UT
DCTN3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81338-ACGLN
DCTN3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81338-ACG
DCTN3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81338-ANG
DCTN3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81338-ACR
DCTN3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81338-ANR
DCTN3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81338-CF
DCTN3 cDNA ORF Clone, Rat, C-His tag RG81338-CH
DCTN3 cDNA ORF Clone, Rat, N-His tag RG81338-NH
DCTN3 cDNA ORF Clone, Rat, C-HA tag RG81338-CY
DCTN3 cDNA ORF Clone, Rat, N-HA tag RG81338-NY
DCTN3 cDNA ORF Clone, Rat, C-Myc tag RG81338-CM
DCTN3 cDNA ORF Clone, Rat, N-Myc tag RG81338-NM
DCTN3 qPCR Primer Pairs, Rat RP301284

DCTN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Mouse MG53793-U
DCTN3 cDNA ORF Clone, Mouse, untagged MG53793-UT
DCTN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53793-ACG
DCTN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53793-ACGLN
DCTN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53793-ANG
DCTN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53793-ACR
DCTN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53793-ANR
DCTN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53793-CF
DCTN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53793-NF
DCTN3 cDNA ORF Clone, Mouse, C-His tag MG53793-CH
DCTN3 cDNA ORF Clone, Mouse, N-His tag MG53793-NH
DCTN3 cDNA ORF Clone, Mouse, C-HA tag MG53793-CY
DCTN3 cDNA ORF Clone, Mouse, N-HA tag MG53793-NY
DCTN3 cDNA ORF Clone, Mouse, C-Myc tag MG53793-CM
DCTN3 cDNA ORF Clone, Mouse, N-Myc tag MG53793-NM

DCTN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Human HG14361-G
DCTN3 cDNA ORF Clone, Human, untagged HG14361-UT
DCTN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14361-ACG
DCTN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14361-ACGLN
DCTN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14361-ANG
DCTN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14361-ACR
DCTN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14361-ANR
DCTN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14361-CF
DCTN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14361-NF
DCTN3 cDNA ORF Clone, Human, C-His tag HG14361-CH
DCTN3 cDNA ORF Clone, Human, N-His tag HG14361-NH
DCTN3 cDNA ORF Clone, Human, C-HA tag HG14361-CY
DCTN3 cDNA ORF Clone, Human, N-HA tag HG14361-NY
DCTN3 cDNA ORF Clone, Human, C-Myc tag HG14361-CM
DCTN3 cDNA ORF Clone, Human, N-Myc tag HG14361-NM
DCTN3 qPCR Primer Pairs, Human HP103010
info info
添加购物车成功! 添加购物车失败!