DDX18 cDNA ORF Clone, Rat, C-His tag

Cat: RG81039-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DDX18 Reagents

CRO Services

Product recommended


All DDX18 Reagents

DDX18 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2025 bp
Description
Full length Clone DNA of Rat DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX18 Background Information

Full Name
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

DDX18 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DDX18 cDNA ORF Clone in Cloning Vector, Rat RG81039-U
DDX18 cDNA ORF Clone, Rat, untagged RG81039-UT
DDX18 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81039-ACGLN
DDX18 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81039-ACG
DDX18 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81039-ANG
DDX18 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81039-ACR
DDX18 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81039-ANR
DDX18 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81039-CF
DDX18 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81039-NF
DDX18 cDNA ORF Clone, Rat, N-His tag RG81039-NH
DDX18 cDNA ORF Clone, Rat, C-HA tag RG81039-CY
DDX18 cDNA ORF Clone, Rat, N-HA tag RG81039-NY
DDX18 cDNA ORF Clone, Rat, C-Myc tag RG81039-CM
DDX18 cDNA ORF Clone, Rat, N-Myc tag RG81039-NM
DDX18 qPCR Primer Pairs, Rat RP301003

DDX18 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX18 cDNA ORF Clone in Cloning Vector, Human HG21518-U
DDX18 cDNA ORF Clone, Human, untagged HG21518-UT
DDX18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21518-ACGLN
DDX18 cDNA ORF Clone, Human, C-GFPSpark® tag HG21518-ACG
DDX18 cDNA ORF Clone, Human, N-GFPSpark® tag HG21518-ANG
DDX18 cDNA ORF Clone, Human, C-OFPSpark® tag HG21518-ACR
DDX18 cDNA ORF Clone, Human, N-OFPSpark® tag HG21518-ANR
DDX18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21518-CF
DDX18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21518-NF
DDX18 cDNA ORF Clone, Human, C-His tag HG21518-CH
DDX18 cDNA ORF Clone, Human, N-His tag HG21518-NH
DDX18 cDNA ORF Clone, Human, C-HA tag HG21518-CY
DDX18 cDNA ORF Clone, Human, N-HA tag HG21518-NY
DDX18 cDNA ORF Clone, Human, C-Myc tag HG21518-CM
DDX18 cDNA ORF Clone, Human, N-Myc tag HG21518-NM
info info
添加购物车成功! 添加购物车失败!