After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 Coagulation Factor X/F10 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat F10 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_017143.2
cDNA 크기:1449bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus coagulation factor X with C terminal Flag tag.
유전자 동의어:F10
:Rat
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

참고자료
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Cat No: RG81157-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".