쥐 Junctional Adhesion Molecule A Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Rat F11R cDNA 클론 제품 정보
Gene_bank_ref_id:NM_053796.1
cDNA 크기:903bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus F11 receptor.
유전자 동의어:Jam1, F11r
:Rat
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

참고자료
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Cat No: RG80240-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".