JAM-A cDNA ORF Clone, Rat, untagged

Cat: RG80240-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All JAM-A Reagents

CRO Services

Product recommended


All JAM-A Reagents

JAM-A cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
903 bp
Description
Full length Clone DNA of Rat F11 receptor.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JAM-A Background Information

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

Full Name
F11 receptor
References
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • JAM-A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    JAM-A cDNA ORF Clone in Cloning Vector, Rat RG80240-G
    JAM-A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80240-ACG
    JAM-A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80240-ACGLN
    JAM-A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80240-ACR
    JAM-A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80240-CF
    JAM-A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80240-NF
    JAM-A cDNA ORF Clone, Rat, C-His tag RG80240-CH
    JAM-A cDNA ORF Clone, Rat, N-His tag RG80240-NH
    JAM-A cDNA ORF Clone, Rat, C-HA tag RG80240-CY
    JAM-A cDNA ORF Clone, Rat, N-HA tag RG80240-NY
    JAM-A cDNA ORF Clone, Rat, C-Myc tag RG80240-CM
    JAM-A cDNA ORF Clone, Rat, N-Myc tag RG80240-NM
    JAM-A qPCR Primer Pairs, Rat RP300226

    JAM-A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    JAM-A cDNA ORF Clone in Cloning Vector, Mouse MG50463-M
    JAM-A cDNA ORF Clone, Mouse, untagged MG50463-UT
    JAM-A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50463-ACGLN
    JAM-A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50463-ACG
    JAM-A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50463-ACR
    JAM-A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50463-CF
    JAM-A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50463-NF
    JAM-A cDNA ORF Clone, Mouse, C-His tag MG50463-CH
    JAM-A cDNA ORF Clone, Mouse, N-His tag MG50463-NH
    JAM-A cDNA ORF Clone, Mouse, C-HA tag MG50463-CY
    JAM-A cDNA ORF Clone, Mouse, N-HA tag MG50463-NY
    JAM-A cDNA ORF Clone, Mouse, C-Myc tag MG50463-CM
    JAM-A cDNA ORF Clone, Mouse, N-Myc tag MG50463-NM
    JAM-A qPCR Primer Pairs, Mouse MP200466

    JAM-A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    JAM-A cDNA ORF Clone in Cloning Vector, Human HG10198-M
    JAM-A cDNA ORF Clone, Human, untagged HG10198-UT
    JAM-A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10198-ACGLN
    JAM-A cDNA ORF Clone, Human, C-GFPSpark® tag HG10198-ACG
    JAM-A cDNA ORF Clone, Human, C-OFPSpark® tag HG10198-ACR
    JAM-A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10198-CF
    JAM-A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10198-NF
    JAM-A cDNA ORF Clone, Human, C-His tag HG10198-CH
    JAM-A cDNA ORF Clone, Human, N-His tag HG10198-NH
    JAM-A cDNA ORF Clone, Human, C-HA tag HG10198-CY
    JAM-A cDNA ORF Clone, Human, N-HA tag HG10198-NY
    JAM-A cDNA ORF Clone, Human, C-Myc tag HG10198-CM
    JAM-A cDNA ORF Clone, Human, N-Myc tag HG10198-NM
    JAM-A qPCR Primer Pairs, Human HP100261
    info info
    添加购物车成功! 添加购物车失败!