FBXL5 cDNA ORF Clone, Rat, N-His tag

Cat: RG81635-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FBXL5 Reagents
CRO Services
Product recommended

All FBXL5 Reagents
FBXL5 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2073 bp
Description
Full length Clone DNA of Rat F-box and leucine-rich repeat protein 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXL5 Background Information
Full Name
F-box and leucine-rich repeat protein 5

FBXL5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FBXL5 cDNA ORF Clone in Cloning Vector, Rat RG81635-G
FBXL5 cDNA ORF Clone, Rat, untagged RG81635-UT
FBXL5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81635-ACG
FBXL5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81635-ACGLN
FBXL5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81635-ACR
FBXL5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81635-CF
FBXL5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81635-NF
FBXL5 cDNA ORF Clone, Rat, C-His tag RG81635-CH
FBXL5 cDNA ORF Clone, Rat, C-HA tag RG81635-CY
FBXL5 cDNA ORF Clone, Rat, N-HA tag RG81635-NY
FBXL5 cDNA ORF Clone, Rat, C-Myc tag RG81635-CM
FBXL5 cDNA ORF Clone, Rat, N-Myc tag RG81635-NM

FBXL5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXL5 cDNA ORF Clone in Cloning Vector, Mouse MG5A3233-U
FBXL5 cDNA ORF Clone, Mouse, untagged MG5A3233-UT
FBXL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3233-ACGLN
FBXL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3233-ACG
FBXL5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3233-ANG
FBXL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3233-ACR
FBXL5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3233-ANR
FBXL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3233-CF
FBXL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3233-NF
FBXL5 cDNA ORF Clone, Mouse, C-His tag MG5A3233-CH
FBXL5 cDNA ORF Clone, Mouse, N-His tag MG5A3233-NH
FBXL5 cDNA ORF Clone, Mouse, C-HA tag MG5A3233-CY
FBXL5 cDNA ORF Clone, Mouse, N-HA tag MG5A3233-NY
FBXL5 cDNA ORF Clone, Mouse, C-Myc tag MG5A3233-CM
FBXL5 cDNA ORF Clone, Mouse, N-Myc tag MG5A3233-NM

FBXL5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FBXL5 cDNA ORF Clone in Cloning Vector, Human HG21460-U
FBXL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21460-ACGLN
info info
添加购物车成功! 添加购物车失败!