쥐 FTH1 Gene ORF cDNA clone expression plasmid, N-Flag 태그

    데이터시트리뷰관련제품프로토콜
     FTH1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_012848.2
    cDNA 크기:549bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus ferritin, heavy polypeptide 1 with N terminal Flag tag.
    유전자 동의어:Fth
    :Rat
    벡터:pCMV3-N-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FTH1 qPCR primers for gene expression analysis, RP301287 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    연구배경

    FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. FTH1 gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 stores iron in a soluble, non-toxic, readily available form. It is important for iron homeostasis. It has ferroxidase activity. Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation. It also plays a role in delivery of iron to cells. FTH1 mediates iron uptake in capsule cells of the developing kidney.

    참고자료
  • Hentze MW, et al. (1986) Cloning, characterization, expression, and chromosomal localization of a human ferritin heavy-chain gene. Proc Natl Acad Sci. 83(19):7226-30.
  • Rual, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Stelzl, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-968.
  • Size / Price
    Cat No: RG81341-NF
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".